Incidental Mutation 'R4421:Olfr1184'
ID327084
Institutional Source Beutler Lab
Gene Symbol Olfr1184
Ensembl Gene ENSMUSG00000051424
Gene Nameolfactory receptor 1184
SynonymsGA_x6K02T2Q125-49974190-49975125, MOR225-3
MMRRC Submission 041142-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R4421 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location88483598-88489284 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 88487241 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Tyrosine at position 170 (N170Y)
Ref Sequence ENSEMBL: ENSMUSP00000149649 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050038] [ENSMUST00000216675]
Predicted Effect probably damaging
Transcript: ENSMUST00000050038
AA Change: N170Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000058679
Gene: ENSMUSG00000051424
AA Change: N170Y

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 2.2e-47 PFAM
Pfam:7tm_1 39 285 2.3e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000216675
AA Change: N170Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acy1 G C 9: 106,435,713 probably null Het
Adgrv1 T C 13: 81,566,302 E234G probably damaging Het
Aga T C 8: 53,511,826 S8P probably benign Het
C1s2 T C 6: 124,625,215 D673G probably benign Het
Capza3 G A 6: 140,042,042 M122I probably benign Het
Cfap44 T C 16: 44,422,437 S735P probably damaging Het
Cntn3 A G 6: 102,464,547 F13L probably damaging Het
Col6a5 A T 9: 105,928,473 M1078K unknown Het
Colgalt2 A T 1: 152,485,012 I267F probably damaging Het
Cpped1 T C 16: 11,805,357 *299W probably null Het
Cyp3a59 A G 5: 146,104,903 probably null Het
Ddx42 T A 11: 106,231,138 Y160N probably damaging Het
Dhx35 A T 2: 158,806,401 R60W probably damaging Het
Gbp10 T C 5: 105,224,651 probably null Het
Gtf2i T C 5: 134,255,037 T467A possibly damaging Het
Hip1r G C 5: 123,997,862 G542A possibly damaging Het
Hspg2 G A 4: 137,548,122 A2748T probably benign Het
Kcnq3 T C 15: 65,995,511 Y761C probably benign Het
Krt13 T G 11: 100,118,935 T340P possibly damaging Het
Map2k5 A G 9: 63,164,130 C435R probably damaging Het
Ms4a4c T A 19: 11,416,375 I53K probably damaging Het
Myh15 T A 16: 49,109,344 F544L probably damaging Het
Neurod2 G T 11: 98,328,200 S46* probably null Het
Nsd3 T A 8: 25,641,272 S218T probably damaging Het
Olfr706 G T 7: 106,886,453 D121E probably damaging Het
Prrc2c TTGCTGCTGCTGCTGCTGCTGCTGCTGC TTGCTGCTGCTGCTGCTGCTGCTGC 1: 162,709,061 probably benign Het
Prrg3 A T X: 71,967,309 S141C probably damaging Het
Ranbp17 A T 11: 33,475,056 D433E probably benign Het
Rbm28 T C 6: 29,154,837 D278G probably damaging Het
Sbpl A G 17: 23,954,886 L8P unknown Het
Spopl C T 2: 23,517,945 V241M probably damaging Het
Tdrd3 A G 14: 87,486,283 E311G probably damaging Het
Tma16 C T 8: 66,484,171 probably null Het
Ubr4 A G 4: 139,461,856 N3917D possibly damaging Het
Vmn2r68 TCC TC 7: 85,221,550 probably null Het
Vmn2r72 T C 7: 85,738,500 N619D probably damaging Het
Xab2 C A 8: 3,614,244 probably null Het
Other mutations in Olfr1184
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01286:Olfr1184 APN 2 88487248 missense probably damaging 1.00
IGL01288:Olfr1184 APN 2 88487248 missense probably damaging 1.00
IGL01790:Olfr1184 APN 2 88486926 missense possibly damaging 0.65
IGL02070:Olfr1184 APN 2 88487002 missense probably damaging 1.00
IGL02247:Olfr1184 APN 2 88487427 missense probably benign 0.00
IGL02932:Olfr1184 APN 2 88487175 missense probably benign 0.01
IGL02997:Olfr1184 APN 2 88487388 missense probably damaging 0.99
IGL03161:Olfr1184 APN 2 88487448 missense probably benign 0.01
PIT4531001:Olfr1184 UTSW 2 88487257 missense possibly damaging 0.95
R3713:Olfr1184 UTSW 2 88487443 missense probably damaging 1.00
R3715:Olfr1184 UTSW 2 88487443 missense probably damaging 1.00
R4514:Olfr1184 UTSW 2 88487365 missense probably benign 0.05
R5096:Olfr1184 UTSW 2 88487302 missense possibly damaging 0.89
R5661:Olfr1184 UTSW 2 88487097 missense probably damaging 0.98
R5851:Olfr1184 UTSW 2 88486860 missense possibly damaging 0.54
R6458:Olfr1184 UTSW 2 88487218 missense possibly damaging 0.90
R7073:Olfr1184 UTSW 2 88487307 missense probably benign 0.00
R7102:Olfr1184 UTSW 2 88487148 missense probably damaging 1.00
R7145:Olfr1184 UTSW 2 88487377 missense probably damaging 1.00
R7221:Olfr1184 UTSW 2 88487629 missense probably damaging 0.97
X0063:Olfr1184 UTSW 2 88487490 missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- TCCTAACAGCCATGGCCTTTG -3'
(R):5'- ACCACAGTGATATGAGATGCAC -3'

Sequencing Primer
(F):5'- ATGGCCTTTGACCGCTG -3'
(R):5'- CACAGGTAGAAAGGGCTTTGTGTC -3'
Posted On2015-07-07