Incidental Mutation 'R4421:Dhx35'
ID327085
Institutional Source Beutler Lab
Gene Symbol Dhx35
Ensembl Gene ENSMUSG00000027655
Gene NameDEAH (Asp-Glu-Ala-His) box polypeptide 35
Synonyms1200009D07Rik, Ddx35
MMRRC Submission 041142-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4421 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location158794807-158858214 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 158806401 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 60 (R60W)
Ref Sequence ENSEMBL: ENSMUSP00000119497 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029186] [ENSMUST00000109478] [ENSMUST00000156893]
Predicted Effect probably damaging
Transcript: ENSMUST00000029186
AA Change: R60W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029186
Gene: ENSMUSG00000027655
AA Change: R60W

DomainStartEndE-ValueType
DEXDc 55 248 1.17e-18 SMART
HELICc 299 398 8.76e-18 SMART
HA2 458 549 1.49e-27 SMART
Pfam:OB_NTP_bind 628 660 2.7e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109478
AA Change: R60W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105104
Gene: ENSMUSG00000027655
AA Change: R60W

DomainStartEndE-ValueType
DEXDc 55 248 1.17e-18 SMART
HELICc 299 398 8.76e-18 SMART
HA2 458 549 1.49e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133720
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145692
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146797
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148359
Predicted Effect probably damaging
Transcript: ENSMUST00000156893
AA Change: R60W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119497
Gene: ENSMUSG00000027655
AA Change: R60W

DomainStartEndE-ValueType
PDB:3LLM|B 7 115 1e-10 PDB
Blast:DEXDc 55 119 5e-37 BLAST
SCOP:d1jpna2 63 115 3e-10 SMART
PDB:3KX2|A 116 204 1e-10 PDB
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of the DEAD box protein family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. The function of this gene product which is a member of this family, has not been determined. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jun 2010]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acy1 G C 9: 106,435,713 probably null Het
Adgrv1 T C 13: 81,566,302 E234G probably damaging Het
Aga T C 8: 53,511,826 S8P probably benign Het
C1s2 T C 6: 124,625,215 D673G probably benign Het
Capza3 G A 6: 140,042,042 M122I probably benign Het
Cfap44 T C 16: 44,422,437 S735P probably damaging Het
Cntn3 A G 6: 102,464,547 F13L probably damaging Het
Col6a5 A T 9: 105,928,473 M1078K unknown Het
Colgalt2 A T 1: 152,485,012 I267F probably damaging Het
Cpped1 T C 16: 11,805,357 *299W probably null Het
Cyp3a59 A G 5: 146,104,903 probably null Het
Ddx42 T A 11: 106,231,138 Y160N probably damaging Het
Gbp10 T C 5: 105,224,651 probably null Het
Gtf2i T C 5: 134,255,037 T467A possibly damaging Het
Hip1r G C 5: 123,997,862 G542A possibly damaging Het
Hspg2 G A 4: 137,548,122 A2748T probably benign Het
Kcnq3 T C 15: 65,995,511 Y761C probably benign Het
Krt13 T G 11: 100,118,935 T340P possibly damaging Het
Map2k5 A G 9: 63,164,130 C435R probably damaging Het
Ms4a4c T A 19: 11,416,375 I53K probably damaging Het
Myh15 T A 16: 49,109,344 F544L probably damaging Het
Neurod2 G T 11: 98,328,200 S46* probably null Het
Nsd3 T A 8: 25,641,272 S218T probably damaging Het
Olfr1184 A T 2: 88,487,241 N170Y probably damaging Het
Olfr706 G T 7: 106,886,453 D121E probably damaging Het
Prrc2c TTGCTGCTGCTGCTGCTGCTGCTGCTGC TTGCTGCTGCTGCTGCTGCTGCTGC 1: 162,709,061 probably benign Het
Prrg3 A T X: 71,967,309 S141C probably damaging Het
Ranbp17 A T 11: 33,475,056 D433E probably benign Het
Rbm28 T C 6: 29,154,837 D278G probably damaging Het
Sbpl A G 17: 23,954,886 L8P unknown Het
Spopl C T 2: 23,517,945 V241M probably damaging Het
Tdrd3 A G 14: 87,486,283 E311G probably damaging Het
Tma16 C T 8: 66,484,171 probably null Het
Ubr4 A G 4: 139,461,856 N3917D possibly damaging Het
Vmn2r68 TCC TC 7: 85,221,550 probably null Het
Vmn2r72 T C 7: 85,738,500 N619D probably damaging Het
Xab2 C A 8: 3,614,244 probably null Het
Other mutations in Dhx35
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Dhx35 APN 2 158827916 missense probably damaging 1.00
IGL01942:Dhx35 APN 2 158831864 missense probably damaging 1.00
IGL02899:Dhx35 APN 2 158801450 missense probably damaging 1.00
IGL02927:Dhx35 APN 2 158820416 missense probably damaging 1.00
IGL03224:Dhx35 APN 2 158857132 utr 3 prime probably benign
R0112:Dhx35 UTSW 2 158840620 missense probably damaging 0.99
R0200:Dhx35 UTSW 2 158829623 missense probably benign
R0609:Dhx35 UTSW 2 158817415 missense possibly damaging 0.62
R0714:Dhx35 UTSW 2 158844183 missense probably benign
R0884:Dhx35 UTSW 2 158831711 missense probably damaging 0.97
R1775:Dhx35 UTSW 2 158806437 missense probably damaging 1.00
R1912:Dhx35 UTSW 2 158842307 missense probably damaging 0.96
R2136:Dhx35 UTSW 2 158831861 missense probably damaging 1.00
R4094:Dhx35 UTSW 2 158842356 missense probably damaging 1.00
R4364:Dhx35 UTSW 2 158842352 nonsense probably null
R4565:Dhx35 UTSW 2 158849535 missense probably benign 0.01
R5517:Dhx35 UTSW 2 158834912 missense probably damaging 1.00
R5732:Dhx35 UTSW 2 158831785 missense probably damaging 0.99
R5979:Dhx35 UTSW 2 158842869 missense probably benign 0.29
R6054:Dhx35 UTSW 2 158818299 missense probably benign 0.00
R6405:Dhx35 UTSW 2 158794919 missense probably damaging 1.00
R6452:Dhx35 UTSW 2 158831687 missense probably damaging 1.00
R6519:Dhx35 UTSW 2 158831710 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GTTCACATGTTCTATAGGTGTTCC -3'
(R):5'- CTTGAGAGGAGACGTTGATCAC -3'

Sequencing Primer
(F):5'- TGGCTCATGCTGACACCAC -3'
(R):5'- CGTTGATCACAGTAATGACTATCCC -3'
Posted On2015-07-07