Incidental Mutation 'R4421:Dhx35'
ID 327085
Institutional Source Beutler Lab
Gene Symbol Dhx35
Ensembl Gene ENSMUSG00000027655
Gene Name DEAH-box helicase 35
Synonyms 1200009D07Rik, Ddx35
MMRRC Submission 041142-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4421 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 158636727-158700134 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 158648321 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Tryptophan at position 60 (R60W)
Ref Sequence ENSEMBL: ENSMUSP00000119497 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029186] [ENSMUST00000109478] [ENSMUST00000156893]
AlphaFold A2ACQ1
Predicted Effect probably damaging
Transcript: ENSMUST00000029186
AA Change: R60W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029186
Gene: ENSMUSG00000027655
AA Change: R60W

DomainStartEndE-ValueType
DEXDc 55 248 1.17e-18 SMART
HELICc 299 398 8.76e-18 SMART
HA2 458 549 1.49e-27 SMART
Pfam:OB_NTP_bind 628 660 2.7e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109478
AA Change: R60W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105104
Gene: ENSMUSG00000027655
AA Change: R60W

DomainStartEndE-ValueType
DEXDc 55 248 1.17e-18 SMART
HELICc 299 398 8.76e-18 SMART
HA2 458 549 1.49e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133720
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145692
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146797
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148359
Predicted Effect probably damaging
Transcript: ENSMUST00000156893
AA Change: R60W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119497
Gene: ENSMUSG00000027655
AA Change: R60W

DomainStartEndE-ValueType
PDB:3LLM|B 7 115 1e-10 PDB
Blast:DEXDc 55 119 5e-37 BLAST
SCOP:d1jpna2 63 115 3e-10 SMART
PDB:3KX2|A 116 204 1e-10 PDB
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of the DEAD box protein family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. The function of this gene product which is a member of this family, has not been determined. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jun 2010]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acy1 G C 9: 106,312,912 (GRCm39) probably null Het
Adgrv1 T C 13: 81,714,421 (GRCm39) E234G probably damaging Het
Aga T C 8: 53,964,861 (GRCm39) S8P probably benign Het
C1s2 T C 6: 124,602,174 (GRCm39) D673G probably benign Het
Capza3 G A 6: 139,987,768 (GRCm39) M122I probably benign Het
Cfap44 T C 16: 44,242,800 (GRCm39) S735P probably damaging Het
Cntn3 A G 6: 102,441,508 (GRCm39) F13L probably damaging Het
Col6a5 A T 9: 105,805,672 (GRCm39) M1078K unknown Het
Colgalt2 A T 1: 152,360,763 (GRCm39) I267F probably damaging Het
Cpped1 T C 16: 11,623,221 (GRCm39) *299W probably null Het
Cyp3a59 A G 5: 146,041,713 (GRCm39) probably null Het
Ddx42 T A 11: 106,121,964 (GRCm39) Y160N probably damaging Het
Gbp10 T C 5: 105,372,517 (GRCm39) probably null Het
Gtf2i T C 5: 134,283,891 (GRCm39) T467A possibly damaging Het
Hip1r G C 5: 124,135,925 (GRCm39) G542A possibly damaging Het
Hspg2 G A 4: 137,275,433 (GRCm39) A2748T probably benign Het
Kcnq3 T C 15: 65,867,360 (GRCm39) Y761C probably benign Het
Krt13 T G 11: 100,009,761 (GRCm39) T340P possibly damaging Het
Map2k5 A G 9: 63,071,412 (GRCm39) C435R probably damaging Het
Ms4a4c T A 19: 11,393,739 (GRCm39) I53K probably damaging Het
Myh15 T A 16: 48,929,707 (GRCm39) F544L probably damaging Het
Neurod2 G T 11: 98,219,026 (GRCm39) S46* probably null Het
Nsd3 T A 8: 26,131,288 (GRCm39) S218T probably damaging Het
Or2ag2 G T 7: 106,485,660 (GRCm39) D121E probably damaging Het
Or4p22 A T 2: 88,317,585 (GRCm39) N170Y probably damaging Het
Prrc2c TTGCTGCTGCTGCTGCTGCTGCTGCTGC TTGCTGCTGCTGCTGCTGCTGCTGC 1: 162,536,630 (GRCm39) probably benign Het
Prrg3 A T X: 71,010,915 (GRCm39) S141C probably damaging Het
Ranbp17 A T 11: 33,425,056 (GRCm39) D433E probably benign Het
Rbm28 T C 6: 29,154,836 (GRCm39) D278G probably damaging Het
Sbpl A G 17: 24,173,860 (GRCm39) L8P unknown Het
Spopl C T 2: 23,407,957 (GRCm39) V241M probably damaging Het
Tdrd3 A G 14: 87,723,719 (GRCm39) E311G probably damaging Het
Tma16 C T 8: 66,936,823 (GRCm39) probably null Het
Ubr4 A G 4: 139,189,167 (GRCm39) N3917D possibly damaging Het
Vmn2r68 TCC TC 7: 84,870,758 (GRCm39) probably null Het
Vmn2r72 T C 7: 85,387,708 (GRCm39) N619D probably damaging Het
Xab2 C A 8: 3,664,244 (GRCm39) probably null Het
Other mutations in Dhx35
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Dhx35 APN 2 158,669,836 (GRCm39) missense probably damaging 1.00
IGL01942:Dhx35 APN 2 158,673,784 (GRCm39) missense probably damaging 1.00
IGL02899:Dhx35 APN 2 158,643,370 (GRCm39) missense probably damaging 1.00
IGL02927:Dhx35 APN 2 158,662,336 (GRCm39) missense probably damaging 1.00
IGL03224:Dhx35 APN 2 158,699,052 (GRCm39) utr 3 prime probably benign
R0112:Dhx35 UTSW 2 158,682,540 (GRCm39) missense probably damaging 0.99
R0200:Dhx35 UTSW 2 158,671,543 (GRCm39) missense probably benign
R0609:Dhx35 UTSW 2 158,659,335 (GRCm39) missense possibly damaging 0.62
R0714:Dhx35 UTSW 2 158,686,103 (GRCm39) missense probably benign
R0884:Dhx35 UTSW 2 158,673,631 (GRCm39) missense probably damaging 0.97
R1775:Dhx35 UTSW 2 158,648,357 (GRCm39) missense probably damaging 1.00
R1912:Dhx35 UTSW 2 158,684,227 (GRCm39) missense probably damaging 0.96
R2136:Dhx35 UTSW 2 158,673,781 (GRCm39) missense probably damaging 1.00
R4094:Dhx35 UTSW 2 158,684,276 (GRCm39) missense probably damaging 1.00
R4364:Dhx35 UTSW 2 158,684,272 (GRCm39) nonsense probably null
R4565:Dhx35 UTSW 2 158,691,455 (GRCm39) missense probably benign 0.01
R5517:Dhx35 UTSW 2 158,676,832 (GRCm39) missense probably damaging 1.00
R5732:Dhx35 UTSW 2 158,673,705 (GRCm39) missense probably damaging 0.99
R5979:Dhx35 UTSW 2 158,684,789 (GRCm39) missense probably benign 0.29
R6054:Dhx35 UTSW 2 158,660,219 (GRCm39) missense probably benign 0.00
R6405:Dhx35 UTSW 2 158,636,839 (GRCm39) missense probably damaging 1.00
R6452:Dhx35 UTSW 2 158,673,607 (GRCm39) missense probably damaging 1.00
R6519:Dhx35 UTSW 2 158,673,630 (GRCm39) missense probably damaging 0.97
R8700:Dhx35 UTSW 2 158,682,552 (GRCm39) missense possibly damaging 0.61
R8894:Dhx35 UTSW 2 158,676,795 (GRCm39) missense possibly damaging 0.77
R8906:Dhx35 UTSW 2 158,648,918 (GRCm39) missense possibly damaging 0.90
R8960:Dhx35 UTSW 2 158,657,393 (GRCm39) missense possibly damaging 0.83
R9349:Dhx35 UTSW 2 158,671,444 (GRCm39) missense possibly damaging 0.94
R9765:Dhx35 UTSW 2 158,671,501 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTTCACATGTTCTATAGGTGTTCC -3'
(R):5'- CTTGAGAGGAGACGTTGATCAC -3'

Sequencing Primer
(F):5'- TGGCTCATGCTGACACCAC -3'
(R):5'- CGTTGATCACAGTAATGACTATCCC -3'
Posted On 2015-07-07