Mutagenetix > Incidental Mutations

Incidental Mutation 'R4421:Dhx35'

327085

Institutional Source

Beutler Lab

Gene Symbol

Dhx35

Ensembl Gene

ENSMUSG00000027655

Gene Name

DEAH (Asp-Glu-Ala-His) box polypeptide 35

Synonyms

1200009D07Rik, Ddx35

MMRRC Submission

041142-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4421 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

158794807-158858214 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 158806401 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Tryptophan at position 60 (R60W)

Ref Sequence

ENSEMBL: ENSMUSP00000119497 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029186] [ENSMUST00000109478] [ENSMUST00000156893]

Predicted Effect

probably damaging
Transcript: ENSMUST00000029186
AA Change: R60W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000029186
Gene: ENSMUSG00000027655
AA Change: R60W

Domain	Start	End	E-Value	Type
DEXDc	55	248	1.17e-18	SMART
HELICc	299	398	8.76e-18	SMART
HA2	458	549	1.49e-27	SMART
Pfam:OB_NTP_bind	628	660	2.7e-10	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000109478
AA Change: R60W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000105104
Gene: ENSMUSG00000027655
AA Change: R60W

Domain	Start	End	E-Value	Type
DEXDc	55	248	1.17e-18	SMART
HELICc	299	398	8.76e-18	SMART
HA2	458	549	1.49e-27	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000133720

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145692

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000146797

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000148359

Predicted Effect

probably damaging
Transcript: ENSMUST00000156893
AA Change: R60W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000119497
Gene: ENSMUSG00000027655
AA Change: R60W

Domain	Start	End	E-Value	Type
PDB:3LLM\|B	7	115	1e-10	PDB
Blast:DEXDc	55	119	5e-37	BLAST
SCOP:d1jpna2	63	115	3e-10	SMART
PDB:3KX2\|A	116	204	1e-10	PDB

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of the DEAD box protein family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. The function of this gene product which is a member of this family, has not been determined. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jun 2010]

Allele List at MGI

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acy1	G	C	9: 106,435,713		probably null	Het
Adgrv1	T	C	13: 81,566,302	E234G	probably damaging	Het
Aga	T	C	8: 53,511,826	S8P	probably benign	Het
C1s2	T	C	6: 124,625,215	D673G	probably benign	Het
Capza3	G	A	6: 140,042,042	M122I	probably benign	Het
Cfap44	T	C	16: 44,422,437	S735P	probably damaging	Het
Cntn3	A	G	6: 102,464,547	F13L	probably damaging	Het
Col6a5	A	T	9: 105,928,473	M1078K	unknown	Het
Colgalt2	A	T	1: 152,485,012	I267F	probably damaging	Het
Cpped1	T	C	16: 11,805,357	*299W	probably null	Het
Cyp3a59	A	G	5: 146,104,903		probably null	Het
Ddx42	T	A	11: 106,231,138	Y160N	probably damaging	Het
Gbp10	T	C	5: 105,224,651		probably null	Het
Gtf2i	T	C	5: 134,255,037	T467A	possibly damaging	Het
Hip1r	G	C	5: 123,997,862	G542A	possibly damaging	Het
Hspg2	G	A	4: 137,548,122	A2748T	probably benign	Het
Kcnq3	T	C	15: 65,995,511	Y761C	probably benign	Het
Krt13	T	G	11: 100,118,935	T340P	possibly damaging	Het
Map2k5	A	G	9: 63,164,130	C435R	probably damaging	Het
Ms4a4c	T	A	19: 11,416,375	I53K	probably damaging	Het
Myh15	T	A	16: 49,109,344	F544L	probably damaging	Het
Neurod2	G	T	11: 98,328,200	S46*	probably null	Het
Nsd3	T	A	8: 25,641,272	S218T	probably damaging	Het
Olfr1184	A	T	2: 88,487,241	N170Y	probably damaging	Het
Olfr706	G	T	7: 106,886,453	D121E	probably damaging	Het
Prrc2c	TTGCTGCTGCTGCTGCTGCTGCTGCTGC	TTGCTGCTGCTGCTGCTGCTGCTGC	1: 162,709,061		probably benign	Het
Prrg3	A	T	X: 71,967,309	S141C	probably damaging	Het
Ranbp17	A	T	11: 33,475,056	D433E	probably benign	Het
Rbm28	T	C	6: 29,154,837	D278G	probably damaging	Het
Sbpl	A	G	17: 23,954,886	L8P	unknown	Het
Spopl	C	T	2: 23,517,945	V241M	probably damaging	Het
Tdrd3	A	G	14: 87,486,283	E311G	probably damaging	Het
Tma16	C	T	8: 66,484,171		probably null	Het
Ubr4	A	G	4: 139,461,856	N3917D	possibly damaging	Het
Vmn2r68	TCC	TC	7: 85,221,550		probably null	Het
Vmn2r72	T	C	7: 85,738,500	N619D	probably damaging	Het
Xab2	C	A	8: 3,614,244		probably null	Het

Other mutations in Dhx35

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00093:Dhx35	APN	2	158827916	missense	probably damaging	1.00
IGL01942:Dhx35	APN	2	158831864	missense	probably damaging	1.00
IGL02899:Dhx35	APN	2	158801450	missense	probably damaging	1.00
IGL02927:Dhx35	APN	2	158820416	missense	probably damaging	1.00
IGL03224:Dhx35	APN	2	158857132	utr 3 prime	probably benign
R0112:Dhx35	UTSW	2	158840620	missense	probably damaging	0.99
R0200:Dhx35	UTSW	2	158829623	missense	probably benign
R0609:Dhx35	UTSW	2	158817415	missense	possibly damaging	0.62
R0714:Dhx35	UTSW	2	158844183	missense	probably benign
R0884:Dhx35	UTSW	2	158831711	missense	probably damaging	0.97
R1775:Dhx35	UTSW	2	158806437	missense	probably damaging	1.00
R1912:Dhx35	UTSW	2	158842307	missense	probably damaging	0.96
R2136:Dhx35	UTSW	2	158831861	missense	probably damaging	1.00
R4094:Dhx35	UTSW	2	158842356	missense	probably damaging	1.00
R4364:Dhx35	UTSW	2	158842352	nonsense	probably null
R4565:Dhx35	UTSW	2	158849535	missense	probably benign	0.01
R5517:Dhx35	UTSW	2	158834912	missense	probably damaging	1.00
R5732:Dhx35	UTSW	2	158831785	missense	probably damaging	0.99
R5979:Dhx35	UTSW	2	158842869	missense	probably benign	0.29
R6054:Dhx35	UTSW	2	158818299	missense	probably benign	0.00
R6405:Dhx35	UTSW	2	158794919	missense	probably damaging	1.00
R6452:Dhx35	UTSW	2	158831687	missense	probably damaging	1.00
R6519:Dhx35	UTSW	2	158831710	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- GTTCACATGTTCTATAGGTGTTCC -3'
(R):5'- CTTGAGAGGAGACGTTGATCAC -3'

Sequencing Primer
(F):5'- TGGCTCATGCTGACACCAC -3'
(R):5'- CGTTGATCACAGTAATGACTATCCC -3'

Posted On

2015-07-07