Mutagenetix > Incidental Mutations

Incidental Mutation 'R4421:Hip1r'

327090

Institutional Source

Beutler Lab

Gene Symbol

Hip1r

Ensembl Gene

ENSMUSG00000000915

Gene Name

huntingtin interacting protein 1 related

Synonyms

MMRRC Submission

041142-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4421 (G1)

Quality Score

178

Status

Not validated

Chromosome

Chromosomal Location

123973628-124005558 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to C at 123997862 bp

Zygosity

Heterozygous

Amino Acid Change

Glycine to Alanine at position 542 (G542A)

Ref Sequence

ENSEMBL: ENSMUSP00000000939 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000000939]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000000939
AA Change: G542A

PolyPhen 2 Score 0.659 (Sensitivity: 0.86; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000000939
Gene: ENSMUSG00000000915
AA Change: G542A

Domain	Start	End	E-Value	Type
ENTH	29	151	5.27e-40	SMART
low complexity region	301	321	N/A	INTRINSIC
PDB:3I00\|B	340	458	1e-21	PDB
Pfam:HIP1_clath_bdg	461	559	1.1e-34	PFAM
low complexity region	627	633	N/A	INTRINSIC
ILWEQ	814	1012	9.19e-121	SMART
low complexity region	1016	1035	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000166258

SMART Domains

Protein: ENSMUSP00000130766
Gene: ENSMUSG00000000915

Domain	Start	End	E-Value	Type
Pfam:ANTH	1	79	3.5e-19	PFAM
low complexity region	80	100	N/A	INTRINSIC
low complexity region	103	114	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000166684

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000167325

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000171407

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000185154

Predicted Effect

probably benign
Transcript: ENSMUST00000198664

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.4%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for disruptions in this gene display no abnormal phenotype. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acy1	G	C	9: 106,435,713		probably null	Het
Adgrv1	T	C	13: 81,566,302	E234G	probably damaging	Het
Aga	T	C	8: 53,511,826	S8P	probably benign	Het
C1s2	T	C	6: 124,625,215	D673G	probably benign	Het
Capza3	G	A	6: 140,042,042	M122I	probably benign	Het
Cfap44	T	C	16: 44,422,437	S735P	probably damaging	Het
Cntn3	A	G	6: 102,464,547	F13L	probably damaging	Het
Col6a5	A	T	9: 105,928,473	M1078K	unknown	Het
Colgalt2	A	T	1: 152,485,012	I267F	probably damaging	Het
Cpped1	T	C	16: 11,805,357	*299W	probably null	Het
Cyp3a59	A	G	5: 146,104,903		probably null	Het
Ddx42	T	A	11: 106,231,138	Y160N	probably damaging	Het
Dhx35	A	T	2: 158,806,401	R60W	probably damaging	Het
Gbp10	T	C	5: 105,224,651		probably null	Het
Gtf2i	T	C	5: 134,255,037	T467A	possibly damaging	Het
Hspg2	G	A	4: 137,548,122	A2748T	probably benign	Het
Kcnq3	T	C	15: 65,995,511	Y761C	probably benign	Het
Krt13	T	G	11: 100,118,935	T340P	possibly damaging	Het
Map2k5	A	G	9: 63,164,130	C435R	probably damaging	Het
Ms4a4c	T	A	19: 11,416,375	I53K	probably damaging	Het
Myh15	T	A	16: 49,109,344	F544L	probably damaging	Het
Neurod2	G	T	11: 98,328,200	S46*	probably null	Het
Nsd3	T	A	8: 25,641,272	S218T	probably damaging	Het
Olfr1184	A	T	2: 88,487,241	N170Y	probably damaging	Het
Olfr706	G	T	7: 106,886,453	D121E	probably damaging	Het
Prrc2c	TTGCTGCTGCTGCTGCTGCTGCTGCTGC	TTGCTGCTGCTGCTGCTGCTGCTGC	1: 162,709,061		probably benign	Het
Prrg3	A	T	X: 71,967,309	S141C	probably damaging	Het
Ranbp17	A	T	11: 33,475,056	D433E	probably benign	Het
Rbm28	T	C	6: 29,154,837	D278G	probably damaging	Het
Sbpl	A	G	17: 23,954,886	L8P	unknown	Het
Spopl	C	T	2: 23,517,945	V241M	probably damaging	Het
Tdrd3	A	G	14: 87,486,283	E311G	probably damaging	Het
Tma16	C	T	8: 66,484,171		probably null	Het
Ubr4	A	G	4: 139,461,856	N3917D	possibly damaging	Het
Vmn2r68	TCC	TC	7: 85,221,550		probably null	Het
Vmn2r72	T	C	7: 85,738,500	N619D	probably damaging	Het
Xab2	C	A	8: 3,614,244		probably null	Het

Other mutations in Hip1r

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00089:Hip1r	APN	5	123989735	critical splice donor site	probably null
IGL01771:Hip1r	APN	5	123999543	missense	possibly damaging	0.95
IGL01804:Hip1r	APN	5	124001550	critical splice donor site	probably null
IGL02100:Hip1r	APN	5	123998943	unclassified	probably benign
IGL02139:Hip1r	APN	5	123996244	missense	probably damaging	1.00
IGL02321:Hip1r	APN	5	123999890	missense	probably damaging	0.99
IGL02562:Hip1r	APN	5	123991523	unclassified	probably benign
IGL02745:Hip1r	APN	5	123990939	splice site	probably null
IGL02798:Hip1r	APN	5	123994712	unclassified	probably benign
IGL03365:Hip1r	APN	5	124000167	missense	probably damaging	1.00
R0172:Hip1r	UTSW	5	123996940	missense	possibly damaging	0.47
R0546:Hip1r	UTSW	5	123999051	missense	possibly damaging	0.89
R0799:Hip1r	UTSW	5	123996941	missense	probably benign	0.00
R1588:Hip1r	UTSW	5	123996575	missense	probably damaging	0.98
R1590:Hip1r	UTSW	5	124002140	missense	probably benign	0.00
R1675:Hip1r	UTSW	5	123994820	missense	probably damaging	1.00
R1801:Hip1r	UTSW	5	123998808	missense	probably benign
R1818:Hip1r	UTSW	5	123995955	critical splice donor site	probably null
R1852:Hip1r	UTSW	5	123991505	missense	probably benign	0.10
R1936:Hip1r	UTSW	5	123996071	missense	probably damaging	1.00
R1954:Hip1r	UTSW	5	124001844	missense	probably damaging	0.96
R1989:Hip1r	UTSW	5	123989698	missense	probably damaging	1.00
R2045:Hip1r	UTSW	5	124000731	missense	probably benign
R2105:Hip1r	UTSW	5	124000204	missense	probably damaging	0.96
R2414:Hip1r	UTSW	5	124001243	missense	probably damaging	1.00
R2909:Hip1r	UTSW	5	124000593	splice site	probably null
R3125:Hip1r	UTSW	5	124000141	missense	probably benign	0.20
R3401:Hip1r	UTSW	5	123996983	missense	probably damaging	1.00
R3402:Hip1r	UTSW	5	123996983	missense	probably damaging	1.00
R3889:Hip1r	UTSW	5	124001791	nonsense	probably null
R4212:Hip1r	UTSW	5	123999890	missense	probably benign	0.06
R4422:Hip1r	UTSW	5	123997006	missense	possibly damaging	0.93
R4713:Hip1r	UTSW	5	123989980	missense	probably benign	0.02
R6837:Hip1r	UTSW	5	123998865	missense	possibly damaging	0.63
R7171:Hip1r	UTSW	5	123995944	missense	probably benign	0.02
R7212:Hip1r	UTSW	5	123973782	missense	possibly damaging	0.91
R7251:Hip1r	UTSW	5	123994750	missense	probably damaging	1.00
R7319:Hip1r	UTSW	5	123999111	missense	probably damaging	1.00
R7432:Hip1r	UTSW	5	123991766	missense	probably benign	0.05
R7592:Hip1r	UTSW	5	123997973	missense	probably benign	0.21
R7708:Hip1r	UTSW	5	123997469	missense	possibly damaging	0.82
R7773:Hip1r	UTSW	5	124001441	missense	probably benign	0.00
R8132:Hip1r	UTSW	5	123997227	missense	probably damaging	1.00
Z1088:Hip1r	UTSW	5	123999132	splice site	probably null
Z1176:Hip1r	UTSW	5	123997010	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CGACCAGTTGGAGAAGCTCAAG -3'
(R):5'- TAAAGGGATGCCAGGCTCTG -3'

Sequencing Primer
(F):5'- CTGAGCCGCACAGAACAGG -3'
(R):5'- CTGCCCGACAAGAAGGTG -3'

Posted On

2015-07-07