Incidental Mutation 'R4421:Gtf2i'
ID327091
Institutional Source Beutler Lab
Gene Symbol Gtf2i
Ensembl Gene ENSMUSG00000060261
Gene Namegeneral transcription factor II I
SynonymsBAP-135, 6030441I21Rik, TFII-I
MMRRC Submission 041142-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4421 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location134237834-134314760 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 134255037 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 467 (T467A)
Ref Sequence ENSEMBL: ENSMUSP00000134035 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059042] [ENSMUST00000082057] [ENSMUST00000111261] [ENSMUST00000172715] [ENSMUST00000173341] [ENSMUST00000173888] [ENSMUST00000174155] [ENSMUST00000174354] [ENSMUST00000174513] [ENSMUST00000174772]
Predicted Effect probably benign
Transcript: ENSMUST00000059042
AA Change: T552A

PolyPhen 2 Score 0.387 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000049625
Gene: ENSMUSG00000060261
AA Change: T552A

DomainStartEndE-ValueType
low complexity region 82 94 N/A INTRINSIC
Pfam:GTF2I 112 187 1.4e-34 PFAM
low complexity region 328 338 N/A INTRINSIC
Pfam:GTF2I 361 436 3.4e-33 PFAM
Pfam:GTF2I 466 541 5e-34 PFAM
Pfam:GTF2I 571 646 3.3e-33 PFAM
Pfam:GTF2I 733 808 3.9e-33 PFAM
Pfam:GTF2I 868 943 9.4e-30 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000082057
AA Change: T531A

PolyPhen 2 Score 0.594 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000080714
Gene: ENSMUSG00000060261
AA Change: T531A

DomainStartEndE-ValueType
low complexity region 82 94 N/A INTRINSIC
Pfam:GTF2I 112 187 1.3e-34 PFAM
low complexity region 307 317 N/A INTRINSIC
Pfam:GTF2I 340 415 3.3e-33 PFAM
Pfam:GTF2I 445 520 4.9e-34 PFAM
Pfam:GTF2I 550 625 3.2e-33 PFAM
Pfam:GTF2I 712 787 3.8e-33 PFAM
Pfam:GTF2I 847 922 9.1e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111261
AA Change: T533A

PolyPhen 2 Score 0.282 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000106892
Gene: ENSMUSG00000060261
AA Change: T533A

DomainStartEndE-ValueType
low complexity region 82 94 N/A INTRINSIC
Pfam:GTF2I 112 187 1.3e-34 PFAM
low complexity region 309 319 N/A INTRINSIC
Pfam:GTF2I 342 417 3.3e-33 PFAM
Pfam:GTF2I 447 522 4.9e-34 PFAM
Pfam:GTF2I 552 627 3.2e-33 PFAM
Pfam:GTF2I 714 789 3.8e-33 PFAM
Pfam:GTF2I 849 924 9.1e-30 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000172715
AA Change: T467A

PolyPhen 2 Score 0.855 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000134035
Gene: ENSMUSG00000060261
AA Change: T467A

DomainStartEndE-ValueType
low complexity region 82 94 N/A INTRINSIC
Pfam:GTF2I 112 187 9.7e-35 PFAM
low complexity region 243 253 N/A INTRINSIC
Pfam:GTF2I 276 351 2.4e-33 PFAM
Pfam:GTF2I 381 456 3.6e-34 PFAM
Pfam:GTF2I 486 561 2.4e-33 PFAM
Pfam:GTF2I 648 723 2.8e-33 PFAM
Pfam:GTF2I 783 858 6.7e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172904
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172953
Predicted Effect probably benign
Transcript: ENSMUST00000173341
AA Change: T512A

PolyPhen 2 Score 0.285 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000133444
Gene: ENSMUSG00000060261
AA Change: T512A

DomainStartEndE-ValueType
low complexity region 82 94 N/A INTRINSIC
Pfam:GTF2I 112 187 1e-34 PFAM
low complexity region 288 298 N/A INTRINSIC
Pfam:GTF2I 321 396 2.6e-33 PFAM
Pfam:GTF2I 426 501 3.8e-34 PFAM
Pfam:GTF2I 531 606 2.5e-33 PFAM
Pfam:GTF2I 693 768 3e-33 PFAM
Pfam:GTF2I 832 907 7.1e-30 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000173888
AA Change: T493A

PolyPhen 2 Score 0.846 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000133969
Gene: ENSMUSG00000060261
AA Change: T493A

DomainStartEndE-ValueType
low complexity region 82 94 N/A INTRINSIC
Pfam:GTF2I 112 187 1.3e-34 PFAM
low complexity region 245 258 N/A INTRINSIC
low complexity region 269 279 N/A INTRINSIC
Pfam:GTF2I 302 377 3.2e-33 PFAM
Pfam:GTF2I 407 482 4.6e-34 PFAM
Pfam:GTF2I 512 587 3.1e-33 PFAM
Pfam:GTF2I 674 749 3.6e-33 PFAM
Pfam:GTF2I 809 884 8.7e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174133
SMART Domains Protein: ENSMUSP00000134111
Gene: ENSMUSG00000060261

DomainStartEndE-ValueType
low complexity region 66 78 N/A INTRINSIC
Pfam:GTF2I 96 170 2.7e-32 PFAM
low complexity region 209 225 N/A INTRINSIC
low complexity region 246 256 N/A INTRINSIC
Pfam:GTF2I 279 353 5.1e-31 PFAM
Pfam:GTF2I 384 437 2.7e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174155
AA Change: T552A

PolyPhen 2 Score 0.387 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000133566
Gene: ENSMUSG00000060261
AA Change: T552A

DomainStartEndE-ValueType
low complexity region 82 94 N/A INTRINSIC
Pfam:GTF2I 112 186 1.6e-34 PFAM
low complexity region 328 338 N/A INTRINSIC
Pfam:GTF2I 361 435 3e-33 PFAM
Pfam:GTF2I 466 540 9.1e-34 PFAM
Pfam:GTF2I 571 645 1.8e-32 PFAM
Pfam:GTF2I 733 807 2.2e-33 PFAM
Pfam:GTF2I 868 942 6e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174182
Predicted Effect probably benign
Transcript: ENSMUST00000174354
AA Change: T533A

PolyPhen 2 Score 0.282 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000134440
Gene: ENSMUSG00000060261
AA Change: T533A

DomainStartEndE-ValueType
low complexity region 82 94 N/A INTRINSIC
Pfam:GTF2I 112 187 1.3e-34 PFAM
low complexity region 309 319 N/A INTRINSIC
Pfam:GTF2I 342 417 3.3e-33 PFAM
Pfam:GTF2I 447 522 4.9e-34 PFAM
Pfam:GTF2I 552 627 3.2e-33 PFAM
Pfam:GTF2I 714 789 3.8e-33 PFAM
Pfam:GTF2I 849 924 9.1e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174513
AA Change: T512A

PolyPhen 2 Score 0.080 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000133489
Gene: ENSMUSG00000060261
AA Change: T512A

DomainStartEndE-ValueType
low complexity region 82 94 N/A INTRINSIC
Pfam:GTF2I 112 187 1.3e-34 PFAM
low complexity region 288 298 N/A INTRINSIC
Pfam:GTF2I 321 396 3.2e-33 PFAM
Pfam:GTF2I 426 501 4.8e-34 PFAM
Pfam:GTF2I 531 606 3.2e-33 PFAM
Pfam:GTF2I 693 768 3.7e-33 PFAM
Pfam:GTF2I 828 903 8.9e-30 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000174772
AA Change: T531A

PolyPhen 2 Score 0.594 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000133740
Gene: ENSMUSG00000060261
AA Change: T531A

DomainStartEndE-ValueType
low complexity region 82 94 N/A INTRINSIC
Pfam:GTF2I 112 187 1.3e-34 PFAM
low complexity region 307 317 N/A INTRINSIC
Pfam:GTF2I 340 415 3.3e-33 PFAM
Pfam:GTF2I 445 520 4.9e-34 PFAM
Pfam:GTF2I 550 625 3.2e-33 PFAM
Pfam:GTF2I 712 787 3.8e-33 PFAM
Pfam:GTF2I 847 922 9.1e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201371
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a phosphoprotein containing six characteristic repeat motifs. The encoded protein binds to the initiator element (Inr) and E-box element in promoters and functions as a regulator of transcription. This locus, along with several other neighboring genes, is deleted in Williams-Beuren syndrome. There are many closely related genes and pseudogenes for this gene on chromosome 7. This gene also has pseudogenes on chromosomes 9, 13, and 21. Alternatively spliced transcript variants encoding multiple isoforms have been observed. [provided by RefSeq, Jul 2013]
PHENOTYPE: Homozygotes for null allele is embryonic lethal, and show brain hemorrhage and neural tube defects. Although most heterozygote are normal and fertile, at low frequency, growth retardation and small head are also reported. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acy1 G C 9: 106,435,713 probably null Het
Adgrv1 T C 13: 81,566,302 E234G probably damaging Het
Aga T C 8: 53,511,826 S8P probably benign Het
C1s2 T C 6: 124,625,215 D673G probably benign Het
Capza3 G A 6: 140,042,042 M122I probably benign Het
Cfap44 T C 16: 44,422,437 S735P probably damaging Het
Cntn3 A G 6: 102,464,547 F13L probably damaging Het
Col6a5 A T 9: 105,928,473 M1078K unknown Het
Colgalt2 A T 1: 152,485,012 I267F probably damaging Het
Cpped1 T C 16: 11,805,357 *299W probably null Het
Cyp3a59 A G 5: 146,104,903 probably null Het
Ddx42 T A 11: 106,231,138 Y160N probably damaging Het
Dhx35 A T 2: 158,806,401 R60W probably damaging Het
Gbp10 T C 5: 105,224,651 probably null Het
Hip1r G C 5: 123,997,862 G542A possibly damaging Het
Hspg2 G A 4: 137,548,122 A2748T probably benign Het
Kcnq3 T C 15: 65,995,511 Y761C probably benign Het
Krt13 T G 11: 100,118,935 T340P possibly damaging Het
Map2k5 A G 9: 63,164,130 C435R probably damaging Het
Ms4a4c T A 19: 11,416,375 I53K probably damaging Het
Myh15 T A 16: 49,109,344 F544L probably damaging Het
Neurod2 G T 11: 98,328,200 S46* probably null Het
Nsd3 T A 8: 25,641,272 S218T probably damaging Het
Olfr1184 A T 2: 88,487,241 N170Y probably damaging Het
Olfr706 G T 7: 106,886,453 D121E probably damaging Het
Prrc2c TTGCTGCTGCTGCTGCTGCTGCTGCTGC TTGCTGCTGCTGCTGCTGCTGCTGC 1: 162,709,061 probably benign Het
Prrg3 A T X: 71,967,309 S141C probably damaging Het
Ranbp17 A T 11: 33,475,056 D433E probably benign Het
Rbm28 T C 6: 29,154,837 D278G probably damaging Het
Sbpl A G 17: 23,954,886 L8P unknown Het
Spopl C T 2: 23,517,945 V241M probably damaging Het
Tdrd3 A G 14: 87,486,283 E311G probably damaging Het
Tma16 C T 8: 66,484,171 probably null Het
Ubr4 A G 4: 139,461,856 N3917D possibly damaging Het
Vmn2r68 TCC TC 7: 85,221,550 probably null Het
Vmn2r72 T C 7: 85,738,500 N619D probably damaging Het
Xab2 C A 8: 3,614,244 probably null Het
Other mutations in Gtf2i
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Gtf2i APN 5 134242748 missense probably damaging 1.00
IGL01565:Gtf2i APN 5 134255913 missense probably damaging 0.97
IGL01743:Gtf2i APN 5 134286893 missense probably damaging 1.00
IGL01809:Gtf2i APN 5 134249950 missense probably damaging 1.00
IGL02553:Gtf2i APN 5 134245161 missense probably damaging 1.00
IGL02814:Gtf2i APN 5 134286704 missense probably damaging 1.00
IGL02869:Gtf2i APN 5 134279427 splice site probably benign
IGL03018:Gtf2i APN 5 134289335 missense possibly damaging 0.79
IGL03051:Gtf2i APN 5 134242914 nonsense probably null
P0041:Gtf2i UTSW 5 134244888 splice site probably benign
R0330:Gtf2i UTSW 5 134251886 missense probably damaging 0.98
R0515:Gtf2i UTSW 5 134242919 missense probably damaging 1.00
R0529:Gtf2i UTSW 5 134261869 nonsense probably null
R0594:Gtf2i UTSW 5 134242173 splice site probably benign
R0650:Gtf2i UTSW 5 134261837 splice site probably benign
R1055:Gtf2i UTSW 5 134263624 missense probably damaging 1.00
R1079:Gtf2i UTSW 5 134242894 splice site probably benign
R1916:Gtf2i UTSW 5 134246848 missense probably damaging 1.00
R2969:Gtf2i UTSW 5 134251892 missense probably damaging 0.98
R3013:Gtf2i UTSW 5 134295504 splice site probably benign
R4392:Gtf2i UTSW 5 134260629 missense probably damaging 0.96
R4635:Gtf2i UTSW 5 134245174 missense probably damaging 1.00
R4763:Gtf2i UTSW 5 134255964 missense probably damaging 1.00
R4770:Gtf2i UTSW 5 134243560 missense possibly damaging 0.53
R5063:Gtf2i UTSW 5 134260571 missense probably damaging 1.00
R5195:Gtf2i UTSW 5 134244832 nonsense probably null
R5829:Gtf2i UTSW 5 134263693 missense probably damaging 1.00
R6005:Gtf2i UTSW 5 134255958 nonsense probably null
R6119:Gtf2i UTSW 5 134287057 splice site probably null
R6576:Gtf2i UTSW 5 134263702 missense probably damaging 1.00
R6936:Gtf2i UTSW 5 134242785 missense probably damaging 1.00
R7070:Gtf2i UTSW 5 134282803 missense probably damaging 1.00
R7071:Gtf2i UTSW 5 134263621 missense probably damaging 1.00
R7142:Gtf2i UTSW 5 134244851 missense possibly damaging 0.95
R7366:Gtf2i UTSW 5 134265749 missense probably damaging 1.00
R7694:Gtf2i UTSW 5 134282805 missense probably damaging 1.00
R7879:Gtf2i UTSW 5 134266617 missense possibly damaging 0.77
R8039:Gtf2i UTSW 5 134255834 missense possibly damaging 0.95
R8041:Gtf2i UTSW 5 134293745 critical splice donor site probably null
R8154:Gtf2i UTSW 5 134251867 missense probably benign 0.07
R8365:Gtf2i UTSW 5 134274580 missense probably benign 0.22
X0022:Gtf2i UTSW 5 134263616 missense probably damaging 1.00
Z1176:Gtf2i UTSW 5 134263645 missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- ATGAGCCAGGATCAAAATTCCC -3'
(R):5'- AAATGGTTCATGTCCTTGCAC -3'

Sequencing Primer
(F):5'- CACTAGGTTAGTCTGAGCGACAC -3'
(R):5'- GGTTCATGTCCTTGCACAAGAAGAC -3'
Posted On2015-07-07