Incidental Mutation 'R4421:Rbm28'
ID327094
Institutional Source Beutler Lab
Gene Symbol Rbm28
Ensembl Gene ENSMUSG00000029701
Gene NameRNA binding motif protein 28
Synonyms2810480G15Rik
MMRRC Submission 041142-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.945) question?
Stock #R4421 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location29123576-29165006 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 29154837 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 278 (D278G)
Ref Sequence ENSEMBL: ENSMUSP00000007993 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007993]
PDB Structure
Solution structure of RRM domain in RNA-binding protein 28 [SOLUTION NMR]
Predicted Effect probably damaging
Transcript: ENSMUST00000007993
AA Change: D278G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000007993
Gene: ENSMUSG00000029701
AA Change: D278G

DomainStartEndE-ValueType
RRM 5 76 3.51e-19 SMART
low complexity region 99 114 N/A INTRINSIC
RRM 115 187 4.52e-22 SMART
low complexity region 225 248 N/A INTRINSIC
low complexity region 267 291 N/A INTRINSIC
low complexity region 294 306 N/A INTRINSIC
RRM 326 405 1.85e-18 SMART
RRM 478 566 5.46e-7 SMART
low complexity region 707 720 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169214
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170473
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170750
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172346
Predicted Effect noncoding transcript
Transcript: ENSMUST00000178237
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a specific nucleolar component of the spliceosomal small nuclear ribonucleoprotein (snRNP)complexes . It specifically associates with U1, U2, U4, U5, and U6 small nuclear RNAs (snRNAs), possibly coordinating their transition through the nucleolus. Mutation in this gene causes alopecia, progressive neurological defects, and endocrinopathy (ANE syndrome), a pleiotropic and clinically heterogeneous disorder. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2009]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acy1 G C 9: 106,435,713 probably null Het
Adgrv1 T C 13: 81,566,302 E234G probably damaging Het
Aga T C 8: 53,511,826 S8P probably benign Het
C1s2 T C 6: 124,625,215 D673G probably benign Het
Capza3 G A 6: 140,042,042 M122I probably benign Het
Cfap44 T C 16: 44,422,437 S735P probably damaging Het
Cntn3 A G 6: 102,464,547 F13L probably damaging Het
Col6a5 A T 9: 105,928,473 M1078K unknown Het
Colgalt2 A T 1: 152,485,012 I267F probably damaging Het
Cpped1 T C 16: 11,805,357 *299W probably null Het
Cyp3a59 A G 5: 146,104,903 probably null Het
Ddx42 T A 11: 106,231,138 Y160N probably damaging Het
Dhx35 A T 2: 158,806,401 R60W probably damaging Het
Gbp10 T C 5: 105,224,651 probably null Het
Gtf2i T C 5: 134,255,037 T467A possibly damaging Het
Hip1r G C 5: 123,997,862 G542A possibly damaging Het
Hspg2 G A 4: 137,548,122 A2748T probably benign Het
Kcnq3 T C 15: 65,995,511 Y761C probably benign Het
Krt13 T G 11: 100,118,935 T340P possibly damaging Het
Map2k5 A G 9: 63,164,130 C435R probably damaging Het
Ms4a4c T A 19: 11,416,375 I53K probably damaging Het
Myh15 T A 16: 49,109,344 F544L probably damaging Het
Neurod2 G T 11: 98,328,200 S46* probably null Het
Nsd3 T A 8: 25,641,272 S218T probably damaging Het
Olfr1184 A T 2: 88,487,241 N170Y probably damaging Het
Olfr706 G T 7: 106,886,453 D121E probably damaging Het
Prrc2c TTGCTGCTGCTGCTGCTGCTGCTGCTGC TTGCTGCTGCTGCTGCTGCTGCTGC 1: 162,709,061 probably benign Het
Prrg3 A T X: 71,967,309 S141C probably damaging Het
Ranbp17 A T 11: 33,475,056 D433E probably benign Het
Sbpl A G 17: 23,954,886 L8P unknown Het
Spopl C T 2: 23,517,945 V241M probably damaging Het
Tdrd3 A G 14: 87,486,283 E311G probably damaging Het
Tma16 C T 8: 66,484,171 probably null Het
Ubr4 A G 4: 139,461,856 N3917D possibly damaging Het
Vmn2r68 TCC TC 7: 85,221,550 probably null Het
Vmn2r72 T C 7: 85,738,500 N619D probably damaging Het
Xab2 C A 8: 3,614,244 probably null Het
Other mutations in Rbm28
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01929:Rbm28 APN 6 29128585 missense possibly damaging 0.94
IGL02097:Rbm28 APN 6 29138618 missense possibly damaging 0.82
IGL02814:Rbm28 APN 6 29159726 missense probably benign 0.34
IGL03212:Rbm28 APN 6 29131275 missense probably damaging 1.00
R0106:Rbm28 UTSW 6 29127803 missense probably benign
R0106:Rbm28 UTSW 6 29127803 missense probably benign
R0109:Rbm28 UTSW 6 29160105 missense probably benign 0.16
R0376:Rbm28 UTSW 6 29158928 splice site probably benign
R0654:Rbm28 UTSW 6 29128578 missense probably damaging 1.00
R0884:Rbm28 UTSW 6 29155154 missense possibly damaging 0.68
R1255:Rbm28 UTSW 6 29158247 missense probably damaging 1.00
R1367:Rbm28 UTSW 6 29137640 missense probably damaging 1.00
R1466:Rbm28 UTSW 6 29155017 splice site probably benign
R2277:Rbm28 UTSW 6 29135514 unclassified probably null
R3917:Rbm28 UTSW 6 29154789 missense probably benign 0.00
R4033:Rbm28 UTSW 6 29159669 missense probably damaging 0.99
R4728:Rbm28 UTSW 6 29143592 missense probably damaging 1.00
R4740:Rbm28 UTSW 6 29125354 utr 3 prime probably benign
R4952:Rbm28 UTSW 6 29138598 missense probably damaging 1.00
R5378:Rbm28 UTSW 6 29128559 missense probably damaging 0.99
R5652:Rbm28 UTSW 6 29135409 missense probably damaging 1.00
R6578:Rbm28 UTSW 6 29137640 missense probably damaging 1.00
R7351:Rbm28 UTSW 6 29158880 missense probably benign
R7770:Rbm28 UTSW 6 29164628 unclassified probably benign
RF056:Rbm28 UTSW 6 29157053 frame shift probably null
Z1176:Rbm28 UTSW 6 29128547 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTTGCAAGAAGCCTGGGCAG -3'
(R):5'- GACCGGAAGCCTAAGGAATC -3'

Sequencing Primer
(F):5'- AGAGCTGGTGTCCACTTCTCG -3'
(R):5'- CAACAATAGCTTCTCCTGTGAGTGTG -3'
Posted On2015-07-07