Incidental Mutation 'R4421:Capza3'
ID327098
Institutional Source Beutler Lab
Gene Symbol Capza3
Ensembl Gene ENSMUSG00000041791
Gene Namecapping protein (actin filament) muscle Z-line, alpha 3
SynonymsGsg3, repro32, 510-4, Tex8, cp alpha3, Cappa3
MMRRC Submission 041142-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.248) question?
Stock #R4421 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location140041252-140042778 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 140042042 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 122 (M122I)
Ref Sequence ENSEMBL: ENSMUSP00000038562 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032356] [ENSMUST00000043797] [ENSMUST00000129986] [ENSMUST00000137148] [ENSMUST00000149931]
Predicted Effect probably benign
Transcript: ENSMUST00000032356
SMART Domains Protein: ENSMUSP00000032356
Gene: ENSMUSG00000030230

DomainStartEndE-ValueType
Pfam:EF-hand_like 80 162 9.6e-26 PFAM
PLCXc 163 307 5.17e-72 SMART
low complexity region 374 385 N/A INTRINSIC
PLCYc 386 502 1.52e-51 SMART
C2 521 625 2.06e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000043797
AA Change: M122I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000038562
Gene: ENSMUSG00000041791
AA Change: M122I

DomainStartEndE-ValueType
Pfam:F-actin_cap_A 12 278 7.3e-65 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000129986
Predicted Effect probably benign
Transcript: ENSMUST00000137148
Predicted Effect probably benign
Transcript: ENSMUST00000149931
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204342
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an actin capping protein, one of the F-actin capping protein alpha subunit family. The encoded protein is predominantly localized to the neck region of ejaculated sperm, other immunohistochemical signals were found in the tail and postacrosomal regions. The encoded protein may also form heterodimers of alpha and beta subunits. This protein may be important in determining sperm architecture and male fertility. [provided by RefSeq, Jul 2008]
PHENOTYPE: Males homozygous for an ENU-induced mutation are infertile, exhibit low epididymal sperm concentrations, and produce sperm with abnormally shaped heads and poor motility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acy1 G C 9: 106,435,713 probably null Het
Adgrv1 T C 13: 81,566,302 E234G probably damaging Het
Aga T C 8: 53,511,826 S8P probably benign Het
C1s2 T C 6: 124,625,215 D673G probably benign Het
Cfap44 T C 16: 44,422,437 S735P probably damaging Het
Cntn3 A G 6: 102,464,547 F13L probably damaging Het
Col6a5 A T 9: 105,928,473 M1078K unknown Het
Colgalt2 A T 1: 152,485,012 I267F probably damaging Het
Cpped1 T C 16: 11,805,357 *299W probably null Het
Cyp3a59 A G 5: 146,104,903 probably null Het
Ddx42 T A 11: 106,231,138 Y160N probably damaging Het
Dhx35 A T 2: 158,806,401 R60W probably damaging Het
Gbp10 T C 5: 105,224,651 probably null Het
Gtf2i T C 5: 134,255,037 T467A possibly damaging Het
Hip1r G C 5: 123,997,862 G542A possibly damaging Het
Hspg2 G A 4: 137,548,122 A2748T probably benign Het
Kcnq3 T C 15: 65,995,511 Y761C probably benign Het
Krt13 T G 11: 100,118,935 T340P possibly damaging Het
Map2k5 A G 9: 63,164,130 C435R probably damaging Het
Ms4a4c T A 19: 11,416,375 I53K probably damaging Het
Myh15 T A 16: 49,109,344 F544L probably damaging Het
Neurod2 G T 11: 98,328,200 S46* probably null Het
Nsd3 T A 8: 25,641,272 S218T probably damaging Het
Olfr1184 A T 2: 88,487,241 N170Y probably damaging Het
Olfr706 G T 7: 106,886,453 D121E probably damaging Het
Prrc2c TTGCTGCTGCTGCTGCTGCTGCTGCTGC TTGCTGCTGCTGCTGCTGCTGCTGC 1: 162,709,061 probably benign Het
Prrg3 A T X: 71,967,309 S141C probably damaging Het
Ranbp17 A T 11: 33,475,056 D433E probably benign Het
Rbm28 T C 6: 29,154,837 D278G probably damaging Het
Sbpl A G 17: 23,954,886 L8P unknown Het
Spopl C T 2: 23,517,945 V241M probably damaging Het
Tdrd3 A G 14: 87,486,283 E311G probably damaging Het
Tma16 C T 8: 66,484,171 probably null Het
Ubr4 A G 4: 139,461,856 N3917D possibly damaging Het
Vmn2r68 TCC TC 7: 85,221,550 probably null Het
Vmn2r72 T C 7: 85,738,500 N619D probably damaging Het
Xab2 C A 8: 3,614,244 probably null Het
Other mutations in Capza3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02138:Capza3 APN 6 140042146 missense probably benign
IGL02228:Capza3 APN 6 140041915 missense probably benign
R1953:Capza3 UTSW 6 140042568 missense possibly damaging 0.59
R4272:Capza3 UTSW 6 140042538 missense probably benign 0.33
R4278:Capza3 UTSW 6 140042060 nonsense probably null
R5504:Capza3 UTSW 6 140042439 missense probably benign 0.42
R7070:Capza3 UTSW 6 140041920 missense probably damaging 1.00
R7661:Capza3 UTSW 6 140041772 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- AAAGCTTATGCACCATCAGGG -3'
(R):5'- CGGGTTTACCTGGAAGATCC -3'

Sequencing Primer
(F):5'- GCACTGCCAAAAATACTGTGTC -3'
(R):5'- GGTTTACCTGGAAGATCCACTTAGAC -3'
Posted On2015-07-07