Incidental Mutation 'R0016:Stc2'
ID32710
Institutional Source Beutler Lab
Gene Symbol Stc2
Ensembl Gene ENSMUSG00000020303
Gene Namestanniocalcin 2
SynonymsStc2l, mustc2
MMRRC Submission 038311-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.316) question?
Stock #R0016 (G1)
Quality Score225
Status Validated (trace)
Chromosome11
Chromosomal Location31357307-31370074 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 31360177 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 286 (D286E)
Ref Sequence ENSEMBL: ENSMUSP00000020546 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020546]
Predicted Effect probably benign
Transcript: ENSMUST00000020546
AA Change: D286E

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000020546
Gene: ENSMUSG00000020303
AA Change: D286E

DomainStartEndE-ValueType
Pfam:Stanniocalcin 12 215 1.4e-94 PFAM
low complexity region 271 282 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139991
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 93.2%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a secreted, homodimeric glycoprotein that is expressed in a wide variety of tissues and may have autocrine or paracrine functions. The encoded protein has 10 of its 15 cysteine residues conserved among stanniocalcin family members and is phosphorylated by casein kinase 2 exclusively on its serine residues. Its C-terminus contains a cluster of histidine residues which may interact with metal ions. The protein may play a role in the regulation of renal and intestinal calcium and phosphate transport, cell metabolism, or cellular calcium/phosphate homeostasis. Constitutive overexpression of human stanniocalcin 2 in mice resulted in pre- and postnatal growth restriction, reduced bone and skeletal muscle growth, and organomegaly. Expression of this gene is induced by estrogen and altered in some breast cancers. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are 10-15% larger and grow at a faster rate than wild-type controls from 4 weeks onward. The increased body weight results from an increase in the weight of most major organs, with the exception of testis. Mean alkaline phosphatase levels are 144% of wild-type levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 A C 1: 71,294,800 V1181G probably benign Het
Adamts12 A T 15: 11,217,829 I291F probably damaging Het
Aspm G C 1: 139,479,544 Q2056H probably benign Het
BC067074 T C 13: 113,366,105 Y115H probably damaging Het
C7 A T 15: 5,046,924 V122E probably benign Het
Casp12 A T 9: 5,352,844 Q152L probably null Het
Cdh16 T A 8: 104,617,632 T92S probably benign Het
Chrd G C 16: 20,734,308 V162L possibly damaging Het
Cpne8 A G 15: 90,501,405 probably benign Het
Cyp2j7 T A 4: 96,202,147 I347F probably damaging Het
Cyp4a10 A T 4: 115,521,107 Q130L probably damaging Het
Dach1 C T 14: 98,168,748 G188R probably damaging Het
Dgkd T C 1: 87,917,952 S294P probably benign Het
Dnah8 A G 17: 30,663,316 I621V probably benign Het
Dync2h1 A G 9: 7,144,346 probably benign Het
Echdc1 A T 10: 29,322,421 probably benign Het
Elovl3 T A 19: 46,132,158 F30Y probably damaging Het
Fa2h T C 8: 111,393,514 Y80C probably damaging Het
Fam208b A C 13: 3,585,170 probably null Het
Fgd3 C T 13: 49,296,609 D55N probably benign Het
Fhod1 T C 8: 105,331,655 E823G possibly damaging Het
Gapvd1 A G 2: 34,699,913 probably benign Het
Gm17067 A T 7: 42,708,622 I152K probably benign Het
Gm1966 G A 7: 106,603,246 L264F probably benign Het
Gm9833 A T 3: 10,089,319 M383L possibly damaging Het
Kif27 A G 13: 58,354,714 V50A probably damaging Het
Kpna2 T C 11: 106,991,086 T305A probably benign Het
Krtap22-2 A G 16: 89,010,519 probably benign Het
Lrp2bp T A 8: 46,012,031 F62L probably damaging Het
Marf1 G A 16: 14,152,265 H197Y probably damaging Het
Mob3b A G 4: 35,083,947 F81L probably benign Het
Mon2 C T 10: 123,035,546 V389M probably damaging Het
Myh8 A G 11: 67,298,525 K1176E probably damaging Het
Naf1 T C 8: 66,889,055 probably benign Het
Nckap1l A G 15: 103,475,636 T554A probably benign Het
Oog3 A G 4: 144,158,071 Y432H probably damaging Het
Paxbp1 A T 16: 91,036,036 probably benign Het
Phf20 A T 2: 156,267,194 K154* probably null Het
Plekhj1 T C 10: 80,796,416 D74G possibly damaging Het
Plpp4 T C 7: 129,323,424 C128R probably damaging Het
Rcan3 A T 4: 135,418,378 probably null Het
Sh3rf1 T A 8: 61,374,138 M642K probably benign Het
Slc7a1 A G 5: 148,334,583 V522A probably benign Het
Sorbs1 A G 19: 40,314,738 probably benign Het
Spry2 C T 14: 105,893,297 V152M probably benign Het
Srgap2 A G 1: 131,349,462 M349T possibly damaging Het
Stag3 A G 5: 138,291,381 H271R possibly damaging Het
Stat4 T C 1: 52,068,780 V136A probably benign Het
Stk31 T C 6: 49,437,377 Y482H probably damaging Het
Ticrr C T 7: 79,693,792 P1135L probably benign Het
Tmem55b C T 14: 50,928,894 R213Q probably damaging Het
Trim27 A T 13: 21,191,229 E310V probably benign Het
Uvrag T C 7: 98,991,981 K284R probably benign Het
Vmn1r78 A C 7: 12,153,352 S297R probably benign Het
Xylt2 A G 11: 94,669,640 S270P probably damaging Het
Zfhx3 T C 8: 108,950,178 M2620T probably benign Het
Zkscan2 C A 7: 123,499,996 probably benign Het
Zwint T C 10: 72,657,198 probably benign Het
Other mutations in Stc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02145:Stc2 APN 11 31367875 splice site probably benign
IGL03330:Stc2 APN 11 31369804 missense probably benign 0.01
R0016:Stc2 UTSW 11 31360177 missense probably benign 0.00
R0025:Stc2 UTSW 11 31365559 intron probably null
R1510:Stc2 UTSW 11 31365418 nonsense probably null
R4581:Stc2 UTSW 11 31365326 splice site probably null
R6106:Stc2 UTSW 11 31360392 missense probably benign
R6252:Stc2 UTSW 11 31360346 missense probably damaging 0.98
R6675:Stc2 UTSW 11 31360307 missense probably benign
R6797:Stc2 UTSW 11 31365351 nonsense probably null
R7192:Stc2 UTSW 11 31369872 start gained probably benign
R7545:Stc2 UTSW 11 31367799 missense probably damaging 1.00
R7570:Stc2 UTSW 11 31367798 missense probably damaging 1.00
R7846:Stc2 UTSW 11 31365413 missense probably benign 0.13
R7929:Stc2 UTSW 11 31365413 missense probably benign 0.13
R8057:Stc2 UTSW 11 31367806 nonsense probably null
Z1176:Stc2 UTSW 11 31360415 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- TGCACGAAGTCCACAATTTGCAC -3'
(R):5'- TTGTGAACCTGCTGCTGACCTG -3'

Sequencing Primer
(F):5'- ATTTGCACACATCCAGCGTG -3'
(R):5'- TCCAGGCTCAGTGTGAACAG -3'
Posted On2013-05-09