Incidental Mutation 'R4421:Nsd3'
ID 327102
Institutional Source Beutler Lab
Gene Symbol Nsd3
Ensembl Gene ENSMUSG00000054823
Gene Name nuclear receptor binding SET domain protein 3
Synonyms Whsc1l1, WHISTLE
MMRRC Submission 041142-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.303) question?
Stock # R4421 (G1)
Quality Score 225
Status Not validated
Chromosome 8
Chromosomal Location 26091617-26209694 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 26131288 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 218 (S218T)
Ref Sequence ENSEMBL: ENSMUSP00000147926 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084026] [ENSMUST00000136107] [ENSMUST00000139966] [ENSMUST00000142395] [ENSMUST00000143445] [ENSMUST00000146919] [ENSMUST00000155861]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000084026
AA Change: S218T

PolyPhen 2 Score 0.280 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000081040
Gene: ENSMUSG00000054823
AA Change: S218T

DomainStartEndE-ValueType
low complexity region 128 151 N/A INTRINSIC
low complexity region 193 225 N/A INTRINSIC
PWWP 278 341 1.6e-12 SMART
low complexity region 680 701 N/A INTRINSIC
PHD 713 756 4.49e-7 SMART
PHD 761 808 5.82e-1 SMART
PHD 809 861 3.06e0 SMART
PHD 874 963 1e-4 SMART
PWWP 968 1030 8.62e-18 SMART
AWS 1103 1154 2.61e-17 SMART
SET 1155 1278 2.17e-41 SMART
PostSET 1279 1295 2.63e-3 SMART
low complexity region 1309 1326 N/A INTRINSIC
PHD 1332 1375 4.32e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000136107
AA Change: S218T

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
Predicted Effect probably benign
Transcript: ENSMUST00000139966
AA Change: S218T

PolyPhen 2 Score 0.280 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000122096
Gene: ENSMUSG00000054823
AA Change: S218T

DomainStartEndE-ValueType
low complexity region 128 151 N/A INTRINSIC
low complexity region 193 225 N/A INTRINSIC
PWWP 278 341 1.6e-12 SMART
low complexity region 680 701 N/A INTRINSIC
PHD 713 756 4.49e-7 SMART
PHD 761 808 5.82e-1 SMART
PHD 809 861 3.06e0 SMART
PHD 874 914 5.24e-8 SMART
PWWP 919 981 8.62e-18 SMART
AWS 1054 1105 2.61e-17 SMART
SET 1106 1229 2.17e-41 SMART
PostSET 1230 1246 2.63e-3 SMART
low complexity region 1260 1277 N/A INTRINSIC
PHD 1283 1326 4.32e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000142395
AA Change: S218T

PolyPhen 2 Score 0.280 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000117778
Gene: ENSMUSG00000054823
AA Change: S218T

DomainStartEndE-ValueType
low complexity region 128 151 N/A INTRINSIC
low complexity region 193 225 N/A INTRINSIC
PWWP 278 341 1.6e-12 SMART
low complexity region 680 701 N/A INTRINSIC
PHD 713 756 4.49e-7 SMART
PHD 761 808 5.82e-1 SMART
PHD 809 861 3.06e0 SMART
PHD 874 963 1e-4 SMART
PWWP 968 1030 8.62e-18 SMART
AWS 1103 1154 2.61e-17 SMART
SET 1155 1278 2.17e-41 SMART
PostSET 1279 1295 2.63e-3 SMART
low complexity region 1309 1326 N/A INTRINSIC
PHD 1332 1375 4.32e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000143445
AA Change: S218T

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000146919
AA Change: S218T

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000115470
Gene: ENSMUSG00000054823
AA Change: S218T

DomainStartEndE-ValueType
low complexity region 128 151 N/A INTRINSIC
low complexity region 193 225 N/A INTRINSIC
Pfam:PWWP 278 388 1.6e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000155861
AA Change: S218T

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000117596
Gene: ENSMUSG00000054823
AA Change: S218T

DomainStartEndE-ValueType
low complexity region 128 151 N/A INTRINSIC
low complexity region 193 225 N/A INTRINSIC
Pfam:PWWP 278 388 1.6e-25 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the SET domain family of histone lysine N-methyltransferase proteins. This protein methylates histone H3 at lysine residues 4 and 27, which represses gene transcription. It acts in opposition to the histone demethylase Jmjd1c. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, May 2015]
Allele List at MGI

All alleles(5) : Gene trapped(5)

Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acy1 G C 9: 106,312,912 (GRCm39) probably null Het
Adgrv1 T C 13: 81,714,421 (GRCm39) E234G probably damaging Het
Aga T C 8: 53,964,861 (GRCm39) S8P probably benign Het
C1s2 T C 6: 124,602,174 (GRCm39) D673G probably benign Het
Capza3 G A 6: 139,987,768 (GRCm39) M122I probably benign Het
Cfap44 T C 16: 44,242,800 (GRCm39) S735P probably damaging Het
Cntn3 A G 6: 102,441,508 (GRCm39) F13L probably damaging Het
Col6a5 A T 9: 105,805,672 (GRCm39) M1078K unknown Het
Colgalt2 A T 1: 152,360,763 (GRCm39) I267F probably damaging Het
Cpped1 T C 16: 11,623,221 (GRCm39) *299W probably null Het
Cyp3a59 A G 5: 146,041,713 (GRCm39) probably null Het
Ddx42 T A 11: 106,121,964 (GRCm39) Y160N probably damaging Het
Dhx35 A T 2: 158,648,321 (GRCm39) R60W probably damaging Het
Gbp10 T C 5: 105,372,517 (GRCm39) probably null Het
Gtf2i T C 5: 134,283,891 (GRCm39) T467A possibly damaging Het
Hip1r G C 5: 124,135,925 (GRCm39) G542A possibly damaging Het
Hspg2 G A 4: 137,275,433 (GRCm39) A2748T probably benign Het
Kcnq3 T C 15: 65,867,360 (GRCm39) Y761C probably benign Het
Krt13 T G 11: 100,009,761 (GRCm39) T340P possibly damaging Het
Map2k5 A G 9: 63,071,412 (GRCm39) C435R probably damaging Het
Ms4a4c T A 19: 11,393,739 (GRCm39) I53K probably damaging Het
Myh15 T A 16: 48,929,707 (GRCm39) F544L probably damaging Het
Neurod2 G T 11: 98,219,026 (GRCm39) S46* probably null Het
Or2ag2 G T 7: 106,485,660 (GRCm39) D121E probably damaging Het
Or4p22 A T 2: 88,317,585 (GRCm39) N170Y probably damaging Het
Prrc2c TTGCTGCTGCTGCTGCTGCTGCTGCTGC TTGCTGCTGCTGCTGCTGCTGCTGC 1: 162,536,630 (GRCm39) probably benign Het
Prrg3 A T X: 71,010,915 (GRCm39) S141C probably damaging Het
Ranbp17 A T 11: 33,425,056 (GRCm39) D433E probably benign Het
Rbm28 T C 6: 29,154,836 (GRCm39) D278G probably damaging Het
Sbpl A G 17: 24,173,860 (GRCm39) L8P unknown Het
Spopl C T 2: 23,407,957 (GRCm39) V241M probably damaging Het
Tdrd3 A G 14: 87,723,719 (GRCm39) E311G probably damaging Het
Tma16 C T 8: 66,936,823 (GRCm39) probably null Het
Ubr4 A G 4: 139,189,167 (GRCm39) N3917D possibly damaging Het
Vmn2r68 TCC TC 7: 84,870,758 (GRCm39) probably null Het
Vmn2r72 T C 7: 85,387,708 (GRCm39) N619D probably damaging Het
Xab2 C A 8: 3,664,244 (GRCm39) probably null Het
Other mutations in Nsd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00435:Nsd3 APN 8 26,166,728 (GRCm39) missense probably benign 0.40
IGL00718:Nsd3 APN 8 26,196,562 (GRCm39) missense probably damaging 0.97
IGL00727:Nsd3 APN 8 26,131,174 (GRCm39) missense probably damaging 1.00
IGL01324:Nsd3 APN 8 26,152,836 (GRCm39) missense probably damaging 1.00
IGL01614:Nsd3 APN 8 26,156,095 (GRCm39) missense possibly damaging 0.65
IGL01834:Nsd3 APN 8 26,130,668 (GRCm39) missense probably damaging 1.00
IGL02066:Nsd3 APN 8 26,203,515 (GRCm39) missense probably damaging 1.00
IGL02229:Nsd3 APN 8 26,200,775 (GRCm39) missense probably damaging 0.98
IGL02481:Nsd3 APN 8 26,181,143 (GRCm39) missense probably damaging 1.00
IGL02686:Nsd3 APN 8 26,156,086 (GRCm39) missense probably damaging 0.96
IGL03394:Nsd3 APN 8 26,165,765 (GRCm39) splice site probably benign
Pine UTSW 8 26,169,952 (GRCm39) missense possibly damaging 0.87
D3080:Nsd3 UTSW 8 26,203,572 (GRCm39) missense possibly damaging 0.77
IGL02802:Nsd3 UTSW 8 26,130,922 (GRCm39) missense probably damaging 1.00
R0136:Nsd3 UTSW 8 26,149,870 (GRCm39) nonsense probably null
R0195:Nsd3 UTSW 8 26,170,709 (GRCm39) missense probably damaging 1.00
R0207:Nsd3 UTSW 8 26,173,273 (GRCm39) missense probably benign 0.02
R0471:Nsd3 UTSW 8 26,138,450 (GRCm39) splice site probably benign
R0511:Nsd3 UTSW 8 26,168,732 (GRCm39) missense possibly damaging 0.81
R0524:Nsd3 UTSW 8 26,190,605 (GRCm39) missense possibly damaging 0.90
R0581:Nsd3 UTSW 8 26,200,718 (GRCm39) missense probably damaging 1.00
R0589:Nsd3 UTSW 8 26,131,303 (GRCm39) missense probably damaging 1.00
R0645:Nsd3 UTSW 8 26,199,096 (GRCm39) missense probably benign 0.08
R0664:Nsd3 UTSW 8 26,204,267 (GRCm39) missense probably damaging 0.97
R0738:Nsd3 UTSW 8 26,168,725 (GRCm39) splice site probably null
R1148:Nsd3 UTSW 8 26,203,407 (GRCm39) missense probably benign 0.09
R1148:Nsd3 UTSW 8 26,203,407 (GRCm39) missense probably benign 0.09
R1265:Nsd3 UTSW 8 26,172,578 (GRCm39) missense probably benign
R1298:Nsd3 UTSW 8 26,169,952 (GRCm39) missense possibly damaging 0.87
R1424:Nsd3 UTSW 8 26,190,594 (GRCm39) missense probably damaging 1.00
R1493:Nsd3 UTSW 8 26,203,407 (GRCm39) missense probably benign 0.09
R1528:Nsd3 UTSW 8 26,188,795 (GRCm39) missense probably damaging 1.00
R2051:Nsd3 UTSW 8 26,181,116 (GRCm39) missense probably damaging 0.99
R2199:Nsd3 UTSW 8 26,156,073 (GRCm39) missense probably damaging 0.99
R3414:Nsd3 UTSW 8 26,190,047 (GRCm39) missense probably damaging 1.00
R3522:Nsd3 UTSW 8 26,196,642 (GRCm39) missense probably benign
R3623:Nsd3 UTSW 8 26,152,835 (GRCm39) missense probably damaging 0.98
R3624:Nsd3 UTSW 8 26,152,835 (GRCm39) missense probably damaging 0.98
R3798:Nsd3 UTSW 8 26,188,873 (GRCm39) missense probably damaging 1.00
R4345:Nsd3 UTSW 8 26,131,333 (GRCm39) missense probably benign 0.04
R4370:Nsd3 UTSW 8 26,138,524 (GRCm39) missense probably benign 0.13
R4583:Nsd3 UTSW 8 26,200,703 (GRCm39) missense probably benign 0.20
R4664:Nsd3 UTSW 8 26,188,894 (GRCm39) missense probably damaging 1.00
R4741:Nsd3 UTSW 8 26,163,382 (GRCm39) missense probably damaging 1.00
R4876:Nsd3 UTSW 8 26,181,161 (GRCm39) missense possibly damaging 0.94
R4888:Nsd3 UTSW 8 26,188,939 (GRCm39) missense probably damaging 1.00
R5000:Nsd3 UTSW 8 26,172,593 (GRCm39) missense probably damaging 1.00
R5132:Nsd3 UTSW 8 26,168,855 (GRCm39) missense possibly damaging 0.73
R5632:Nsd3 UTSW 8 26,169,985 (GRCm39) missense probably benign 0.00
R5760:Nsd3 UTSW 8 26,149,772 (GRCm39) missense probably damaging 1.00
R5778:Nsd3 UTSW 8 26,149,834 (GRCm39) missense probably damaging 1.00
R5779:Nsd3 UTSW 8 26,172,685 (GRCm39) nonsense probably null
R5860:Nsd3 UTSW 8 26,156,107 (GRCm39) missense probably damaging 0.98
R5911:Nsd3 UTSW 8 26,156,092 (GRCm39) missense probably damaging 1.00
R6168:Nsd3 UTSW 8 26,181,188 (GRCm39) missense probably null 1.00
R6467:Nsd3 UTSW 8 26,130,646 (GRCm39) missense probably damaging 1.00
R6490:Nsd3 UTSW 8 26,204,212 (GRCm39) missense probably damaging 1.00
R6519:Nsd3 UTSW 8 26,152,955 (GRCm39) missense probably damaging 1.00
R6554:Nsd3 UTSW 8 26,152,891 (GRCm39) missense probably damaging 0.99
R7038:Nsd3 UTSW 8 26,131,279 (GRCm39) missense probably damaging 1.00
R7088:Nsd3 UTSW 8 26,156,050 (GRCm39) missense probably benign 0.40
R7244:Nsd3 UTSW 8 26,156,055 (GRCm39) missense probably damaging 0.96
R7308:Nsd3 UTSW 8 26,130,740 (GRCm39) missense probably damaging 1.00
R7678:Nsd3 UTSW 8 26,149,833 (GRCm39) missense possibly damaging 0.82
R7717:Nsd3 UTSW 8 26,172,578 (GRCm39) missense probably benign
R8064:Nsd3 UTSW 8 26,190,698 (GRCm39) nonsense probably null
R8242:Nsd3 UTSW 8 26,196,567 (GRCm39) nonsense probably null
R8312:Nsd3 UTSW 8 26,153,268 (GRCm39) missense probably damaging 1.00
R8547:Nsd3 UTSW 8 26,184,811 (GRCm39) missense probably damaging 1.00
R8954:Nsd3 UTSW 8 26,163,394 (GRCm39) missense probably damaging 1.00
R8995:Nsd3 UTSW 8 26,131,169 (GRCm39) missense probably damaging 1.00
R9026:Nsd3 UTSW 8 26,172,576 (GRCm39) missense probably benign 0.10
R9281:Nsd3 UTSW 8 26,152,961 (GRCm39) missense probably benign 0.00
R9320:Nsd3 UTSW 8 26,199,088 (GRCm39) critical splice acceptor site probably null
R9563:Nsd3 UTSW 8 26,204,230 (GRCm39) missense
R9703:Nsd3 UTSW 8 26,131,228 (GRCm39) missense probably benign 0.00
X0026:Nsd3 UTSW 8 26,190,621 (GRCm39) missense probably damaging 1.00
Z1088:Nsd3 UTSW 8 26,131,018 (GRCm39) small deletion probably benign
Predicted Primers PCR Primer
(F):5'- AGGCTCACCCGAGATTAAAC -3'
(R):5'- AAGCAAGACTCTCGGTGTC -3'

Sequencing Primer
(F):5'- TTCCCTTTGTGGAGACCT -3'
(R):5'- GACTCTCGGTGTCAAAAACG -3'
Posted On 2015-07-07