Incidental Mutation 'R4421:Aga'
ID327103
Institutional Source Beutler Lab
Gene Symbol Aga
Ensembl Gene ENSMUSG00000031521
Gene Nameaspartylglucosaminidase
Synonyms
MMRRC Submission 041142-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4421 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location53511727-53523421 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 53511826 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 8 (S8P)
Ref Sequence ENSEMBL: ENSMUSP00000148133 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033920] [ENSMUST00000209811] [ENSMUST00000211424]
Predicted Effect probably benign
Transcript: ENSMUST00000033920
AA Change: S8P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000033920
Gene: ENSMUSG00000031521
AA Change: S8P

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Asparaginase_2 32 333 2.5e-86 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000209811
AA Change: S8P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000211424
AA Change: S8P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes an amidase enzyme that participates in the breakdown of glycoproteins in the cell. The encoded protein undergoes proteolytic processing to generate a mature enzyme. Mice lacking the encoded protein exhibit accumulation of aspartylglucosamine along with lysosomal vacuolization, axonal swelling in the gracile nucleus and impaired neuromotor coordination. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar processing to generate mature protein. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate this gene die prematurely and share most of the clinical, biochemical and histopathological characteristics of human aspartylglycosaminuria. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acy1 G C 9: 106,435,713 probably null Het
Adgrv1 T C 13: 81,566,302 E234G probably damaging Het
C1s2 T C 6: 124,625,215 D673G probably benign Het
Capza3 G A 6: 140,042,042 M122I probably benign Het
Cfap44 T C 16: 44,422,437 S735P probably damaging Het
Cntn3 A G 6: 102,464,547 F13L probably damaging Het
Col6a5 A T 9: 105,928,473 M1078K unknown Het
Colgalt2 A T 1: 152,485,012 I267F probably damaging Het
Cpped1 T C 16: 11,805,357 *299W probably null Het
Cyp3a59 A G 5: 146,104,903 probably null Het
Ddx42 T A 11: 106,231,138 Y160N probably damaging Het
Dhx35 A T 2: 158,806,401 R60W probably damaging Het
Gbp10 T C 5: 105,224,651 probably null Het
Gtf2i T C 5: 134,255,037 T467A possibly damaging Het
Hip1r G C 5: 123,997,862 G542A possibly damaging Het
Hspg2 G A 4: 137,548,122 A2748T probably benign Het
Kcnq3 T C 15: 65,995,511 Y761C probably benign Het
Krt13 T G 11: 100,118,935 T340P possibly damaging Het
Map2k5 A G 9: 63,164,130 C435R probably damaging Het
Ms4a4c T A 19: 11,416,375 I53K probably damaging Het
Myh15 T A 16: 49,109,344 F544L probably damaging Het
Neurod2 G T 11: 98,328,200 S46* probably null Het
Nsd3 T A 8: 25,641,272 S218T probably damaging Het
Olfr1184 A T 2: 88,487,241 N170Y probably damaging Het
Olfr706 G T 7: 106,886,453 D121E probably damaging Het
Prrc2c TTGCTGCTGCTGCTGCTGCTGCTGCTGC TTGCTGCTGCTGCTGCTGCTGCTGC 1: 162,709,061 probably benign Het
Prrg3 A T X: 71,967,309 S141C probably damaging Het
Ranbp17 A T 11: 33,475,056 D433E probably benign Het
Rbm28 T C 6: 29,154,837 D278G probably damaging Het
Sbpl A G 17: 23,954,886 L8P unknown Het
Spopl C T 2: 23,517,945 V241M probably damaging Het
Tdrd3 A G 14: 87,486,283 E311G probably damaging Het
Tma16 C T 8: 66,484,171 probably null Het
Ubr4 A G 4: 139,461,856 N3917D possibly damaging Het
Vmn2r68 TCC TC 7: 85,221,550 probably null Het
Vmn2r72 T C 7: 85,738,500 N619D probably damaging Het
Xab2 C A 8: 3,614,244 probably null Het
Other mutations in Aga
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00503:Aga APN 8 53518921 missense probably benign
IGL02581:Aga APN 8 53521044 splice site probably benign
IGL02617:Aga APN 8 53520313 missense possibly damaging 0.66
IGL03008:Aga APN 8 53511826 missense probably benign
R2099:Aga UTSW 8 53521131 nonsense probably null
R3747:Aga UTSW 8 53517821 missense probably benign
R4018:Aga UTSW 8 53523191 missense probably benign 0.00
R4247:Aga UTSW 8 53511830 missense possibly damaging 0.72
R4399:Aga UTSW 8 53511826 missense probably benign
R4475:Aga UTSW 8 53511836 missense probably damaging 0.98
R5235:Aga UTSW 8 53514326 missense probably damaging 1.00
R5640:Aga UTSW 8 53511884 missense probably damaging 1.00
R7748:Aga UTSW 8 53511805 start codon destroyed possibly damaging 0.79
X0027:Aga UTSW 8 53521156 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GCCAATAGAAGGCCTCGTTG -3'
(R):5'- TCTGGTGTAAAGTCAGAGATGCAG -3'

Sequencing Primer
(F):5'- CAATAGAAGGCCTCGTTGTCTCG -3'
(R):5'- CTGCAACCTTAGGGACTGAGTG -3'
Posted On2015-07-07