Incidental Mutation 'R4421:Tma16'
ID327104
Institutional Source Beutler Lab
Gene Symbol Tma16
Ensembl Gene ENSMUSG00000025591
Gene Nametranslation machinery associated 16
Synonyms
MMRRC Submission 041142-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.942) question?
Stock #R4421 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location66473118-66486530 bp(-) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) C to T at 66484171 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000026681 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026681] [ENSMUST00000143972]
Predicted Effect probably null
Transcript: ENSMUST00000026681
SMART Domains Protein: ENSMUSP00000026681
Gene: ENSMUSG00000025591

DomainStartEndE-ValueType
Pfam:DUF2962 10 162 1.6e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143972
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145787
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213036
Meta Mutation Damage Score 0.9588 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acy1 G C 9: 106,435,713 probably null Het
Adgrv1 T C 13: 81,566,302 E234G probably damaging Het
Aga T C 8: 53,511,826 S8P probably benign Het
C1s2 T C 6: 124,625,215 D673G probably benign Het
Capza3 G A 6: 140,042,042 M122I probably benign Het
Cfap44 T C 16: 44,422,437 S735P probably damaging Het
Cntn3 A G 6: 102,464,547 F13L probably damaging Het
Col6a5 A T 9: 105,928,473 M1078K unknown Het
Colgalt2 A T 1: 152,485,012 I267F probably damaging Het
Cpped1 T C 16: 11,805,357 *299W probably null Het
Cyp3a59 A G 5: 146,104,903 probably null Het
Ddx42 T A 11: 106,231,138 Y160N probably damaging Het
Dhx35 A T 2: 158,806,401 R60W probably damaging Het
Gbp10 T C 5: 105,224,651 probably null Het
Gtf2i T C 5: 134,255,037 T467A possibly damaging Het
Hip1r G C 5: 123,997,862 G542A possibly damaging Het
Hspg2 G A 4: 137,548,122 A2748T probably benign Het
Kcnq3 T C 15: 65,995,511 Y761C probably benign Het
Krt13 T G 11: 100,118,935 T340P possibly damaging Het
Map2k5 A G 9: 63,164,130 C435R probably damaging Het
Ms4a4c T A 19: 11,416,375 I53K probably damaging Het
Myh15 T A 16: 49,109,344 F544L probably damaging Het
Neurod2 G T 11: 98,328,200 S46* probably null Het
Nsd3 T A 8: 25,641,272 S218T probably damaging Het
Olfr1184 A T 2: 88,487,241 N170Y probably damaging Het
Olfr706 G T 7: 106,886,453 D121E probably damaging Het
Prrc2c TTGCTGCTGCTGCTGCTGCTGCTGCTGC TTGCTGCTGCTGCTGCTGCTGCTGC 1: 162,709,061 probably benign Het
Prrg3 A T X: 71,967,309 S141C probably damaging Het
Ranbp17 A T 11: 33,475,056 D433E probably benign Het
Rbm28 T C 6: 29,154,837 D278G probably damaging Het
Sbpl A G 17: 23,954,886 L8P unknown Het
Spopl C T 2: 23,517,945 V241M probably damaging Het
Tdrd3 A G 14: 87,486,283 E311G probably damaging Het
Ubr4 A G 4: 139,461,856 N3917D possibly damaging Het
Vmn2r68 TCC TC 7: 85,221,550 probably null Het
Vmn2r72 T C 7: 85,738,500 N619D probably damaging Het
Xab2 C A 8: 3,614,244 probably null Het
Other mutations in Tma16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00233:Tma16 APN 8 66480445 missense probably benign 0.00
IGL01321:Tma16 APN 8 66476860 missense probably benign 0.02
IGL02022:Tma16 APN 8 66486410 critical splice donor site probably null
R0064:Tma16 UTSW 8 66476805 missense possibly damaging 0.46
R3401:Tma16 UTSW 8 66484171 critical splice acceptor site probably null
R3402:Tma16 UTSW 8 66484171 critical splice acceptor site probably null
R3403:Tma16 UTSW 8 66484171 critical splice acceptor site probably null
R4399:Tma16 UTSW 8 66484171 critical splice acceptor site probably null
R4402:Tma16 UTSW 8 66484171 critical splice acceptor site probably null
R4453:Tma16 UTSW 8 66484171 critical splice acceptor site probably null
R4493:Tma16 UTSW 8 66484171 critical splice acceptor site probably null
R4856:Tma16 UTSW 8 66481477 missense probably damaging 1.00
R4886:Tma16 UTSW 8 66481477 missense probably damaging 1.00
R5527:Tma16 UTSW 8 66484124 missense possibly damaging 0.94
R6312:Tma16 UTSW 8 66481466 missense probably damaging 0.99
R8437:Tma16 UTSW 8 66476796 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- CACCTGATAAGTAGATGCATAAAGGC -3'
(R):5'- TAAGCTGGCATGGCTGAGTC -3'

Sequencing Primer
(F):5'- GATGCATAAAGGCGCTTTCC -3'
(R):5'- ATGGCTGAGTCACTGAGCG -3'
Posted On2015-07-07