Mutagenetix > Incidental Mutations

Incidental Mutation 'R4421:Ranbp17'

327108

Institutional Source

Beutler Lab

Gene Symbol

Ranbp17

Ensembl Gene

ENSMUSG00000040594

Gene Name

RAN binding protein 17

Synonyms

4932704E15Rik

MMRRC Submission

041142-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4421 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

33211795-33513746 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 33475056 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 433 (D433E)

Ref Sequence

ENSEMBL: ENSMUSP00000137898 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000037522] [ENSMUST00000102815] [ENSMUST00000129179]

Predicted Effect

probably benign
Transcript: ENSMUST00000037522
AA Change: D433E

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000035840
Gene: ENSMUSG00000040594
AA Change: D433E

Domain	Start	End	E-Value	Type
IBN_N	30	95	3.24e-5	SMART
low complexity region	270	283	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000102815
AA Change: D433E

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000099879
Gene: ENSMUSG00000040594
AA Change: D433E

Domain	Start	End	E-Value	Type
IBN_N	30	95	3.24e-5	SMART
low complexity region	270	283	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000129179
AA Change: D433E

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)

SMART Domains

Protein: ENSMUSP00000137898
Gene: ENSMUSG00000040594
AA Change: D433E

Domain	Start	End	E-Value	Type
IBN_N	30	95	3.24e-5	SMART
low complexity region	270	283	N/A	INTRINSIC

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The transport of protein and large RNAs through the nuclear pore complexes (NPC) is an energy-dependent and regulated process. The import of proteins with a nuclear localization signal (NLS) is accomplished by recognition of one or more clusters of basic amino acids by the importin-alpha/beta complex; see MIM 600685 and MIM 602738. The small GTPase RAN (MIM 601179) plays a key role in NLS-dependent protein import. RAN-binding protein-17 is a member of the importin-beta superfamily of nuclear transport receptors.[supplied by OMIM, Jul 2002]

Allele List at MGI

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acy1	G	C	9: 106,435,713		probably null	Het
Adgrv1	T	C	13: 81,566,302	E234G	probably damaging	Het
Aga	T	C	8: 53,511,826	S8P	probably benign	Het
C1s2	T	C	6: 124,625,215	D673G	probably benign	Het
Capza3	G	A	6: 140,042,042	M122I	probably benign	Het
Cfap44	T	C	16: 44,422,437	S735P	probably damaging	Het
Cntn3	A	G	6: 102,464,547	F13L	probably damaging	Het
Col6a5	A	T	9: 105,928,473	M1078K	unknown	Het
Colgalt2	A	T	1: 152,485,012	I267F	probably damaging	Het
Cpped1	T	C	16: 11,805,357	*299W	probably null	Het
Cyp3a59	A	G	5: 146,104,903		probably null	Het
Ddx42	T	A	11: 106,231,138	Y160N	probably damaging	Het
Dhx35	A	T	2: 158,806,401	R60W	probably damaging	Het
Gbp10	T	C	5: 105,224,651		probably null	Het
Gtf2i	T	C	5: 134,255,037	T467A	possibly damaging	Het
Hip1r	G	C	5: 123,997,862	G542A	possibly damaging	Het
Hspg2	G	A	4: 137,548,122	A2748T	probably benign	Het
Kcnq3	T	C	15: 65,995,511	Y761C	probably benign	Het
Krt13	T	G	11: 100,118,935	T340P	possibly damaging	Het
Map2k5	A	G	9: 63,164,130	C435R	probably damaging	Het
Ms4a4c	T	A	19: 11,416,375	I53K	probably damaging	Het
Myh15	T	A	16: 49,109,344	F544L	probably damaging	Het
Neurod2	G	T	11: 98,328,200	S46*	probably null	Het
Nsd3	T	A	8: 25,641,272	S218T	probably damaging	Het
Olfr1184	A	T	2: 88,487,241	N170Y	probably damaging	Het
Olfr706	G	T	7: 106,886,453	D121E	probably damaging	Het
Prrc2c	TTGCTGCTGCTGCTGCTGCTGCTGCTGC	TTGCTGCTGCTGCTGCTGCTGCTGC	1: 162,709,061		probably benign	Het
Prrg3	A	T	X: 71,967,309	S141C	probably damaging	Het
Rbm28	T	C	6: 29,154,837	D278G	probably damaging	Het
Sbpl	A	G	17: 23,954,886	L8P	unknown	Het
Spopl	C	T	2: 23,517,945	V241M	probably damaging	Het
Tdrd3	A	G	14: 87,486,283	E311G	probably damaging	Het
Tma16	C	T	8: 66,484,171		probably null	Het
Ubr4	A	G	4: 139,461,856	N3917D	possibly damaging	Het
Vmn2r68	TCC	TC	7: 85,221,550		probably null	Het
Vmn2r72	T	C	7: 85,738,500	N619D	probably damaging	Het
Xab2	C	A	8: 3,614,244		probably null	Het

Other mutations in Ranbp17

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00509:Ranbp17	APN	11	33493402	missense	probably benign	0.13
IGL00582:Ranbp17	APN	11	33504683	missense	probably damaging	0.99
IGL00698:Ranbp17	APN	11	33441910	missense	probably benign	0.00
IGL00789:Ranbp17	APN	11	33243249	missense	probably benign	0.27
IGL01304:Ranbp17	APN	11	33266147	missense	possibly damaging	0.91
IGL01936:Ranbp17	APN	11	33487689	missense	probably benign	0.00
IGL01937:Ranbp17	APN	11	33328520	missense	possibly damaging	0.73
IGL01945:Ranbp17	APN	11	33328520	missense	possibly damaging	0.73
IGL01993:Ranbp17	APN	11	33500770	missense	possibly damaging	0.48
IGL02588:Ranbp17	APN	11	33217361	missense	probably benign
IGL02870:Ranbp17	APN	11	33243262	missense	probably damaging	1.00
IGL03149:Ranbp17	APN	11	33243183	missense	possibly damaging	0.76
PIT4445001:Ranbp17	UTSW	11	33481020	critical splice donor site	probably null
PIT4480001:Ranbp17	UTSW	11	33297340	critical splice donor site	probably null
R0079:Ranbp17	UTSW	11	33500682	missense	probably damaging	1.00
R0349:Ranbp17	UTSW	11	33500689	missense	probably benign
R0395:Ranbp17	UTSW	11	33474896	missense	probably benign
R1456:Ranbp17	UTSW	11	33266310	missense	probably damaging	1.00
R1539:Ranbp17	UTSW	11	33297394	missense	probably damaging	0.99
R1542:Ranbp17	UTSW	11	33264672	missense	probably benign
R1770:Ranbp17	UTSW	11	33217301	missense	probably benign	0.31
R2216:Ranbp17	UTSW	11	33481125	missense	probably damaging	1.00
R2656:Ranbp17	UTSW	11	33243122	missense	probably benign
R2883:Ranbp17	UTSW	11	33504708	missense	probably damaging	1.00
R3498:Ranbp17	UTSW	11	33219203	small deletion	probably benign
R3499:Ranbp17	UTSW	11	33219203	small deletion	probably benign
R3721:Ranbp17	UTSW	11	33219203	small deletion	probably benign
R3788:Ranbp17	UTSW	11	33219203	small deletion	probably benign
R3790:Ranbp17	UTSW	11	33219203	small deletion	probably benign
R3914:Ranbp17	UTSW	11	33479189	missense	probably benign	0.02
R3915:Ranbp17	UTSW	11	33479189	missense	probably benign	0.02
R3949:Ranbp17	UTSW	11	33479189	missense	probably benign	0.02
R4021:Ranbp17	UTSW	11	33479189	missense	probably benign	0.02
R4022:Ranbp17	UTSW	11	33479189	missense	probably benign	0.02
R4027:Ranbp17	UTSW	11	33500718	missense	possibly damaging	0.67
R4462:Ranbp17	UTSW	11	33217421	critical splice acceptor site	probably null
R4659:Ranbp17	UTSW	11	33266288	missense	probably damaging	1.00
R4791:Ranbp17	UTSW	11	33487746	missense	probably benign	0.11
R4837:Ranbp17	UTSW	11	33328451	missense	probably damaging	1.00
R4914:Ranbp17	UTSW	11	33213425	missense	probably benign
R4939:Ranbp17	UTSW	11	33219223	missense	probably benign	0.31
R5119:Ranbp17	UTSW	11	33404181	makesense	probably null
R5171:Ranbp17	UTSW	11	33217419	missense	probably benign
R5182:Ranbp17	UTSW	11	33219287	intron	probably benign
R5288:Ranbp17	UTSW	11	33219241	missense	possibly damaging	0.75
R5384:Ranbp17	UTSW	11	33219241	missense	possibly damaging	0.75
R5385:Ranbp17	UTSW	11	33219241	missense	possibly damaging	0.75
R5398:Ranbp17	UTSW	11	33474998	missense	probably damaging	1.00
R6658:Ranbp17	UTSW	11	33219214	nonsense	probably null
R6701:Ranbp17	UTSW	11	33475066	missense	probably damaging	1.00
R6796:Ranbp17	UTSW	11	33217398	missense	probably benign
R6869:Ranbp17	UTSW	11	33513074	start gained	probably benign
R7096:Ranbp17	UTSW	11	33474896	missense	probably benign
R7156:Ranbp17	UTSW	11	33297420	missense	probably damaging	1.00
R7451:Ranbp17	UTSW	11	33284114	splice site	probably null
R7958:Ranbp17	UTSW	11	33487702	missense	probably damaging	1.00
RF016:Ranbp17	UTSW	11	33329511	missense	probably damaging	0.99
X0013:Ranbp17	UTSW	11	33289562	splice site	probably null
X0024:Ranbp17	UTSW	11	33213404	makesense	probably null
Z1176:Ranbp17	UTSW	11	33481108	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACCTTCTTGAATCGCCATGTCAAC -3'
(R):5'- GCAGCAGGTTTGTATTTTGAACTAG -3'

Sequencing Primer
(F):5'- TCGCCATGTCAACAGCCAG -3'
(R):5'- TGTAGACCAGACTGGCCTTGAAC -3'

Posted On

2015-07-07