Incidental Mutation 'R4421:Neurod2'
ID327109
Institutional Source Beutler Lab
Gene Symbol Neurod2
Ensembl Gene ENSMUSG00000038255
Gene Nameneurogenic differentiation 2
SynonymsbHLHa1, Ndrf
MMRRC Submission 041142-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.843) question?
Stock #R4421 (G1)
Quality Score146
Status Not validated
Chromosome11
Chromosomal Location98325415-98329648 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 98328200 bp
ZygosityHeterozygous
Amino Acid Change Serine to Stop codon at position 46 (S46*)
Ref Sequence ENSEMBL: ENSMUSP00000041373 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041685]
Predicted Effect probably null
Transcript: ENSMUST00000041685
AA Change: S46*
SMART Domains Protein: ENSMUSP00000041373
Gene: ENSMUSG00000038255
AA Change: S46*

DomainStartEndE-ValueType
low complexity region 34 57 N/A INTRINSIC
low complexity region 76 111 N/A INTRINSIC
HLH 128 180 4.19e-17 SMART
Pfam:Neuro_bHLH 181 311 5.7e-43 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the neuroD family of neurogenic basic helix-loop-helix (bHLH) proteins. Expression of this gene can induce transcription from neuron-specific promoters, such as the GAP-43 promoter, which contain a specific DNA sequence known as an E-box. The product of the human gene can induce neurogenic differentiation in non-neuronal cells in Xenopus embryos, and is thought to play a role in the determination and maintenance of neuronal cell fates. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation show elevated neuronal apoptosis resulting in ataxia, incoordination, elevated seizure susceptibility, and death by 35 days. Heterozygotes are moderately affected, and adults are subject to unexplained death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acy1 G C 9: 106,435,713 probably null Het
Adgrv1 T C 13: 81,566,302 E234G probably damaging Het
Aga T C 8: 53,511,826 S8P probably benign Het
C1s2 T C 6: 124,625,215 D673G probably benign Het
Capza3 G A 6: 140,042,042 M122I probably benign Het
Cfap44 T C 16: 44,422,437 S735P probably damaging Het
Cntn3 A G 6: 102,464,547 F13L probably damaging Het
Col6a5 A T 9: 105,928,473 M1078K unknown Het
Colgalt2 A T 1: 152,485,012 I267F probably damaging Het
Cpped1 T C 16: 11,805,357 *299W probably null Het
Cyp3a59 A G 5: 146,104,903 probably null Het
Ddx42 T A 11: 106,231,138 Y160N probably damaging Het
Dhx35 A T 2: 158,806,401 R60W probably damaging Het
Gbp10 T C 5: 105,224,651 probably null Het
Gtf2i T C 5: 134,255,037 T467A possibly damaging Het
Hip1r G C 5: 123,997,862 G542A possibly damaging Het
Hspg2 G A 4: 137,548,122 A2748T probably benign Het
Kcnq3 T C 15: 65,995,511 Y761C probably benign Het
Krt13 T G 11: 100,118,935 T340P possibly damaging Het
Map2k5 A G 9: 63,164,130 C435R probably damaging Het
Ms4a4c T A 19: 11,416,375 I53K probably damaging Het
Myh15 T A 16: 49,109,344 F544L probably damaging Het
Nsd3 T A 8: 25,641,272 S218T probably damaging Het
Olfr1184 A T 2: 88,487,241 N170Y probably damaging Het
Olfr706 G T 7: 106,886,453 D121E probably damaging Het
Prrc2c TTGCTGCTGCTGCTGCTGCTGCTGCTGC TTGCTGCTGCTGCTGCTGCTGCTGC 1: 162,709,061 probably benign Het
Prrg3 A T X: 71,967,309 S141C probably damaging Het
Ranbp17 A T 11: 33,475,056 D433E probably benign Het
Rbm28 T C 6: 29,154,837 D278G probably damaging Het
Sbpl A G 17: 23,954,886 L8P unknown Het
Spopl C T 2: 23,517,945 V241M probably damaging Het
Tdrd3 A G 14: 87,486,283 E311G probably damaging Het
Tma16 C T 8: 66,484,171 probably null Het
Ubr4 A G 4: 139,461,856 N3917D possibly damaging Het
Vmn2r68 TCC TC 7: 85,221,550 probably null Het
Vmn2r72 T C 7: 85,738,500 N619D probably damaging Het
Xab2 C A 8: 3,614,244 probably null Het
Other mutations in Neurod2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00897:Neurod2 APN 11 98327769 missense probably damaging 1.00
IGL01751:Neurod2 APN 11 98327375 missense possibly damaging 0.94
IGL01752:Neurod2 APN 11 98327375 missense possibly damaging 0.94
IGL02661:Neurod2 APN 11 98327579 missense possibly damaging 0.65
hesitate UTSW 11 98327756 missense probably damaging 1.00
selection UTSW 11 98327321 missense probably benign 0.01
PIT4362001:Neurod2 UTSW 11 98327882 missense probably damaging 1.00
R0904:Neurod2 UTSW 11 98327321 missense probably benign 0.01
R0989:Neurod2 UTSW 11 98327979 missense probably damaging 1.00
R1290:Neurod2 UTSW 11 98327288 missense possibly damaging 0.69
R1564:Neurod2 UTSW 11 98327424 missense probably damaging 0.96
R1712:Neurod2 UTSW 11 98327203 missense probably damaging 1.00
R1901:Neurod2 UTSW 11 98327732 missense probably damaging 1.00
R2129:Neurod2 UTSW 11 98327588 missense possibly damaging 0.73
R2267:Neurod2 UTSW 11 98327756 missense probably damaging 1.00
R3754:Neurod2 UTSW 11 98327700 missense probably damaging 1.00
R5067:Neurod2 UTSW 11 98327237 missense possibly damaging 0.71
R5181:Neurod2 UTSW 11 98327378 missense probably benign 0.43
R7922:Neurod2 UTSW 11 98327628 missense probably benign 0.00
R7976:Neurod2 UTSW 11 98327197 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- ACGCGCCTTGGTCATCTTG -3'
(R):5'- TGGTCAAGCTCTCTGGGACC -3'

Sequencing Primer
(F):5'- GGTCATCTTGCGTTTCTTCGGC -3'
(R):5'- AGAGCAGCTTCCTTCCGG -3'
Posted On2015-07-07