Incidental Mutation 'R4421:Krt13'
ID327110
Institutional Source Beutler Lab
Gene Symbol Krt13
Ensembl Gene ENSMUSG00000044041
Gene Namekeratin 13
SynonymsK13, Krt-1.13, Krt1-13
MMRRC Submission 041142-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.241) question?
Stock #R4421 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location100117327-100121566 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 100118935 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Proline at position 340 (T340P)
Ref Sequence ENSEMBL: ENSMUSP00000007275 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007275]
Predicted Effect possibly damaging
Transcript: ENSMUST00000007275
AA Change: T340P

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000007275
Gene: ENSMUSG00000044041
AA Change: T340P

DomainStartEndE-ValueType
internal_repeat_1 5 21 1.02e-5 PROSPERO
internal_repeat_1 16 32 1.02e-5 PROSPERO
low complexity region 39 94 N/A INTRINSIC
Filament 95 407 7.21e-169 SMART
low complexity region 409 430 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128934
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134282
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the keratin gene family. The keratins are intermediate filament proteins responsible for the structural integrity of epithelial cells and are subdivided into cytokeratins and hair keratins. Most of the type I cytokeratins consist of acidic proteins which are arranged in pairs of heterotypic keratin chains. This type I cytokeratin is paired with keratin 4 and expressed in the suprabasal layers of non-cornified stratified epithelia. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2015]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acy1 G C 9: 106,435,713 probably null Het
Adgrv1 T C 13: 81,566,302 E234G probably damaging Het
Aga T C 8: 53,511,826 S8P probably benign Het
C1s2 T C 6: 124,625,215 D673G probably benign Het
Capza3 G A 6: 140,042,042 M122I probably benign Het
Cfap44 T C 16: 44,422,437 S735P probably damaging Het
Cntn3 A G 6: 102,464,547 F13L probably damaging Het
Col6a5 A T 9: 105,928,473 M1078K unknown Het
Colgalt2 A T 1: 152,485,012 I267F probably damaging Het
Cpped1 T C 16: 11,805,357 *299W probably null Het
Cyp3a59 A G 5: 146,104,903 probably null Het
Ddx42 T A 11: 106,231,138 Y160N probably damaging Het
Dhx35 A T 2: 158,806,401 R60W probably damaging Het
Gbp10 T C 5: 105,224,651 probably null Het
Gtf2i T C 5: 134,255,037 T467A possibly damaging Het
Hip1r G C 5: 123,997,862 G542A possibly damaging Het
Hspg2 G A 4: 137,548,122 A2748T probably benign Het
Kcnq3 T C 15: 65,995,511 Y761C probably benign Het
Map2k5 A G 9: 63,164,130 C435R probably damaging Het
Ms4a4c T A 19: 11,416,375 I53K probably damaging Het
Myh15 T A 16: 49,109,344 F544L probably damaging Het
Neurod2 G T 11: 98,328,200 S46* probably null Het
Nsd3 T A 8: 25,641,272 S218T probably damaging Het
Olfr1184 A T 2: 88,487,241 N170Y probably damaging Het
Olfr706 G T 7: 106,886,453 D121E probably damaging Het
Prrc2c TTGCTGCTGCTGCTGCTGCTGCTGCTGC TTGCTGCTGCTGCTGCTGCTGCTGC 1: 162,709,061 probably benign Het
Prrg3 A T X: 71,967,309 S141C probably damaging Het
Ranbp17 A T 11: 33,475,056 D433E probably benign Het
Rbm28 T C 6: 29,154,837 D278G probably damaging Het
Sbpl A G 17: 23,954,886 L8P unknown Het
Spopl C T 2: 23,517,945 V241M probably damaging Het
Tdrd3 A G 14: 87,486,283 E311G probably damaging Het
Tma16 C T 8: 66,484,171 probably null Het
Ubr4 A G 4: 139,461,856 N3917D possibly damaging Het
Vmn2r68 TCC TC 7: 85,221,550 probably null Het
Vmn2r72 T C 7: 85,738,500 N619D probably damaging Het
Xab2 C A 8: 3,614,244 probably null Het
Other mutations in Krt13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01780:Krt13 APN 11 100119713 missense probably damaging 1.00
IGL02532:Krt13 APN 11 100119369 missense probably damaging 1.00
IGL02934:Krt13 APN 11 100119084 missense probably damaging 0.99
PIT4651001:Krt13 UTSW 11 100120036 missense probably damaging 0.98
R0092:Krt13 UTSW 11 100121432 nonsense probably null
R0722:Krt13 UTSW 11 100119153 missense probably damaging 1.00
R1228:Krt13 UTSW 11 100121477 missense probably benign 0.18
R1400:Krt13 UTSW 11 100121284 missense probably damaging 1.00
R1751:Krt13 UTSW 11 100121100 missense possibly damaging 0.84
R1767:Krt13 UTSW 11 100121100 missense possibly damaging 0.84
R2420:Krt13 UTSW 11 100120051 missense probably benign 0.43
R2421:Krt13 UTSW 11 100120051 missense probably benign 0.43
R2869:Krt13 UTSW 11 100117649 missense unknown
R2869:Krt13 UTSW 11 100117649 missense unknown
R4451:Krt13 UTSW 11 100118001 missense unknown
R4520:Krt13 UTSW 11 100119348 missense probably damaging 0.99
R4632:Krt13 UTSW 11 100121224 missense possibly damaging 0.96
R4656:Krt13 UTSW 11 100119363 missense probably damaging 1.00
R4872:Krt13 UTSW 11 100121506 start gained probably benign
R5709:Krt13 UTSW 11 100117643 missense unknown
R6014:Krt13 UTSW 11 100117611 missense unknown
R6323:Krt13 UTSW 11 100121150 missense probably damaging 1.00
R6391:Krt13 UTSW 11 100119376 missense probably damaging 0.96
R7535:Krt13 UTSW 11 100117998 missense unknown
R7562:Krt13 UTSW 11 100119336 missense probably damaging 1.00
R7867:Krt13 UTSW 11 100121182 missense probably damaging 1.00
R7950:Krt13 UTSW 11 100121182 missense probably damaging 1.00
X0013:Krt13 UTSW 11 100119348 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTTCCCCAAGACAGCAAGTG -3'
(R):5'- GAGATCACAGAACTCAGGCG -3'

Sequencing Primer
(F):5'- GGAACCTACTTAGCATCCTGG -3'
(R):5'- TCAGGCGCACACTCCAG -3'
Posted On2015-07-07