Mutagenetix > Incidental Mutations

Incidental Mutation 'R4421:Krt13'

327110

Institutional Source

Beutler Lab

Gene Symbol

Krt13

Ensembl Gene

ENSMUSG00000044041

Gene Name

keratin 13

Synonyms

K13, Krt-1.13, Krt1-13

MMRRC Submission

041142-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.241) question?

Stock #

R4421 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

100117327-100121566 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 100118935 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Proline at position 340 (T340P)

Ref Sequence

ENSEMBL: ENSMUSP00000007275 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000007275]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000007275
AA Change: T340P

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000007275
Gene: ENSMUSG00000044041
AA Change: T340P

Domain	Start	End	E-Value	Type
internal_repeat_1	5	21	1.02e-5	PROSPERO
internal_repeat_1	16	32	1.02e-5	PROSPERO
low complexity region	39	94	N/A	INTRINSIC
Filament	95	407	7.21e-169	SMART
low complexity region	409	430	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128934

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134282

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.4%

Validation Efficiency

MGI Phenotype

FUNCTION: The protein encoded by this gene is a member of the keratin gene family. The keratins are intermediate filament proteins responsible for the structural integrity of epithelial cells and are subdivided into cytokeratins and hair keratins. Most of the type I cytokeratins consist of acidic proteins which are arranged in pairs of heterotypic keratin chains. This type I cytokeratin is paired with keratin 4 and expressed in the suprabasal layers of non-cornified stratified epithelia. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2015]

Allele List at MGI

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acy1	G	C	9: 106,435,713		probably null	Het
Adgrv1	T	C	13: 81,566,302	E234G	probably damaging	Het
Aga	T	C	8: 53,511,826	S8P	probably benign	Het
C1s2	T	C	6: 124,625,215	D673G	probably benign	Het
Capza3	G	A	6: 140,042,042	M122I	probably benign	Het
Cfap44	T	C	16: 44,422,437	S735P	probably damaging	Het
Cntn3	A	G	6: 102,464,547	F13L	probably damaging	Het
Col6a5	A	T	9: 105,928,473	M1078K	unknown	Het
Colgalt2	A	T	1: 152,485,012	I267F	probably damaging	Het
Cpped1	T	C	16: 11,805,357	*299W	probably null	Het
Cyp3a59	A	G	5: 146,104,903		probably null	Het
Ddx42	T	A	11: 106,231,138	Y160N	probably damaging	Het
Dhx35	A	T	2: 158,806,401	R60W	probably damaging	Het
Gbp10	T	C	5: 105,224,651		probably null	Het
Gtf2i	T	C	5: 134,255,037	T467A	possibly damaging	Het
Hip1r	G	C	5: 123,997,862	G542A	possibly damaging	Het
Hspg2	G	A	4: 137,548,122	A2748T	probably benign	Het
Kcnq3	T	C	15: 65,995,511	Y761C	probably benign	Het
Map2k5	A	G	9: 63,164,130	C435R	probably damaging	Het
Ms4a4c	T	A	19: 11,416,375	I53K	probably damaging	Het
Myh15	T	A	16: 49,109,344	F544L	probably damaging	Het
Neurod2	G	T	11: 98,328,200	S46*	probably null	Het
Nsd3	T	A	8: 25,641,272	S218T	probably damaging	Het
Olfr1184	A	T	2: 88,487,241	N170Y	probably damaging	Het
Olfr706	G	T	7: 106,886,453	D121E	probably damaging	Het
Prrc2c	TTGCTGCTGCTGCTGCTGCTGCTGCTGC	TTGCTGCTGCTGCTGCTGCTGCTGC	1: 162,709,061		probably benign	Het
Prrg3	A	T	X: 71,967,309	S141C	probably damaging	Het
Ranbp17	A	T	11: 33,475,056	D433E	probably benign	Het
Rbm28	T	C	6: 29,154,837	D278G	probably damaging	Het
Sbpl	A	G	17: 23,954,886	L8P	unknown	Het
Spopl	C	T	2: 23,517,945	V241M	probably damaging	Het
Tdrd3	A	G	14: 87,486,283	E311G	probably damaging	Het
Tma16	C	T	8: 66,484,171		probably null	Het
Ubr4	A	G	4: 139,461,856	N3917D	possibly damaging	Het
Vmn2r68	TCC	TC	7: 85,221,550		probably null	Het
Vmn2r72	T	C	7: 85,738,500	N619D	probably damaging	Het
Xab2	C	A	8: 3,614,244		probably null	Het

Other mutations in Krt13

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01780:Krt13	APN	11	100119713	missense	probably damaging	1.00
IGL02532:Krt13	APN	11	100119369	missense	probably damaging	1.00
IGL02934:Krt13	APN	11	100119084	missense	probably damaging	0.99
PIT4651001:Krt13	UTSW	11	100120036	missense	probably damaging	0.98
R0092:Krt13	UTSW	11	100121432	nonsense	probably null
R0722:Krt13	UTSW	11	100119153	missense	probably damaging	1.00
R1228:Krt13	UTSW	11	100121477	missense	probably benign	0.18
R1400:Krt13	UTSW	11	100121284	missense	probably damaging	1.00
R1751:Krt13	UTSW	11	100121100	missense	possibly damaging	0.84
R1767:Krt13	UTSW	11	100121100	missense	possibly damaging	0.84
R2420:Krt13	UTSW	11	100120051	missense	probably benign	0.43
R2421:Krt13	UTSW	11	100120051	missense	probably benign	0.43
R2869:Krt13	UTSW	11	100117649	missense	unknown
R2869:Krt13	UTSW	11	100117649	missense	unknown
R4451:Krt13	UTSW	11	100118001	missense	unknown
R4520:Krt13	UTSW	11	100119348	missense	probably damaging	0.99
R4632:Krt13	UTSW	11	100121224	missense	possibly damaging	0.96
R4656:Krt13	UTSW	11	100119363	missense	probably damaging	1.00
R4872:Krt13	UTSW	11	100121506	start gained	probably benign
R5709:Krt13	UTSW	11	100117643	missense	unknown
R6014:Krt13	UTSW	11	100117611	missense	unknown
R6323:Krt13	UTSW	11	100121150	missense	probably damaging	1.00
R6391:Krt13	UTSW	11	100119376	missense	probably damaging	0.96
R7535:Krt13	UTSW	11	100117998	missense	unknown
R7562:Krt13	UTSW	11	100119336	missense	probably damaging	1.00
R7867:Krt13	UTSW	11	100121182	missense	probably damaging	1.00
R7950:Krt13	UTSW	11	100121182	missense	probably damaging	1.00
X0013:Krt13	UTSW	11	100119348	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- CTTCCCCAAGACAGCAAGTG -3'
(R):5'- GAGATCACAGAACTCAGGCG -3'

Sequencing Primer
(F):5'- GGAACCTACTTAGCATCCTGG -3'
(R):5'- TCAGGCGCACACTCCAG -3'

Posted On

2015-07-07