Incidental Mutation 'R4421:Ddx42'
ID327111
Institutional Source Beutler Lab
Gene Symbol Ddx42
Ensembl Gene ENSMUSG00000020705
Gene NameDEAD (Asp-Glu-Ala-Asp) box polypeptide 42
SynonymsB430002H05Rik, SF3b125, 1810047H21Rik
MMRRC Submission 041142-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4421 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location106216926-106249139 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 106231138 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 160 (Y160N)
Ref Sequence ENSEMBL: ENSMUSP00000021046 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021046]
Predicted Effect probably damaging
Transcript: ENSMUST00000021046
AA Change: Y160N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021046
Gene: ENSMUSG00000020705
AA Change: Y160N

DomainStartEndE-ValueType
low complexity region 6 19 N/A INTRINSIC
low complexity region 35 52 N/A INTRINSIC
low complexity region 68 82 N/A INTRINSIC
low complexity region 108 114 N/A INTRINSIC
coiled coil region 116 143 N/A INTRINSIC
low complexity region 149 158 N/A INTRINSIC
DEXDc 272 474 7.61e-68 SMART
HELICc 512 593 1.58e-33 SMART
low complexity region 644 659 N/A INTRINSIC
low complexity region 722 737 N/A INTRINSIC
low complexity region 814 838 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Asp-Glu-Ala-Asp (DEAD) box protein family. Members of this protein family are putative RNA helicases, and are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. Two transcript variants encoding the same protein have been identified for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acy1 G C 9: 106,435,713 probably null Het
Adgrv1 T C 13: 81,566,302 E234G probably damaging Het
Aga T C 8: 53,511,826 S8P probably benign Het
C1s2 T C 6: 124,625,215 D673G probably benign Het
Capza3 G A 6: 140,042,042 M122I probably benign Het
Cfap44 T C 16: 44,422,437 S735P probably damaging Het
Cntn3 A G 6: 102,464,547 F13L probably damaging Het
Col6a5 A T 9: 105,928,473 M1078K unknown Het
Colgalt2 A T 1: 152,485,012 I267F probably damaging Het
Cpped1 T C 16: 11,805,357 *299W probably null Het
Cyp3a59 A G 5: 146,104,903 probably null Het
Dhx35 A T 2: 158,806,401 R60W probably damaging Het
Gbp10 T C 5: 105,224,651 probably null Het
Gtf2i T C 5: 134,255,037 T467A possibly damaging Het
Hip1r G C 5: 123,997,862 G542A possibly damaging Het
Hspg2 G A 4: 137,548,122 A2748T probably benign Het
Kcnq3 T C 15: 65,995,511 Y761C probably benign Het
Krt13 T G 11: 100,118,935 T340P possibly damaging Het
Map2k5 A G 9: 63,164,130 C435R probably damaging Het
Ms4a4c T A 19: 11,416,375 I53K probably damaging Het
Myh15 T A 16: 49,109,344 F544L probably damaging Het
Neurod2 G T 11: 98,328,200 S46* probably null Het
Nsd3 T A 8: 25,641,272 S218T probably damaging Het
Olfr1184 A T 2: 88,487,241 N170Y probably damaging Het
Olfr706 G T 7: 106,886,453 D121E probably damaging Het
Prrc2c TTGCTGCTGCTGCTGCTGCTGCTGCTGC TTGCTGCTGCTGCTGCTGCTGCTGC 1: 162,709,061 probably benign Het
Prrg3 A T X: 71,967,309 S141C probably damaging Het
Ranbp17 A T 11: 33,475,056 D433E probably benign Het
Rbm28 T C 6: 29,154,837 D278G probably damaging Het
Sbpl A G 17: 23,954,886 L8P unknown Het
Spopl C T 2: 23,517,945 V241M probably damaging Het
Tdrd3 A G 14: 87,486,283 E311G probably damaging Het
Tma16 C T 8: 66,484,171 probably null Het
Ubr4 A G 4: 139,461,856 N3917D possibly damaging Het
Vmn2r68 TCC TC 7: 85,221,550 probably null Het
Vmn2r72 T C 7: 85,738,500 N619D probably damaging Het
Xab2 C A 8: 3,614,244 probably null Het
Other mutations in Ddx42
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00719:Ddx42 APN 11 106235749 missense probably damaging 0.98
IGL00833:Ddx42 APN 11 106231178 missense possibly damaging 0.52
IGL01095:Ddx42 APN 11 106247499 missense probably damaging 1.00
IGL01651:Ddx42 APN 11 106248029 missense probably benign 0.00
IGL01715:Ddx42 APN 11 106224275 missense probably damaging 1.00
IGL02097:Ddx42 APN 11 106239160 missense probably benign 0.00
IGL03182:Ddx42 APN 11 106247527 missense probably benign
P0045:Ddx42 UTSW 11 106231272 missense probably damaging 1.00
R0504:Ddx42 UTSW 11 106247849 missense probably benign 0.03
R0646:Ddx42 UTSW 11 106232833 missense probably benign 0.00
R2277:Ddx42 UTSW 11 106242939 missense probably damaging 1.00
R2279:Ddx42 UTSW 11 106242939 missense probably damaging 1.00
R2297:Ddx42 UTSW 11 106242939 missense probably damaging 1.00
R2336:Ddx42 UTSW 11 106231150 missense possibly damaging 0.56
R2519:Ddx42 UTSW 11 106245329 missense probably damaging 1.00
R3413:Ddx42 UTSW 11 106247810 missense probably benign 0.00
R3498:Ddx42 UTSW 11 106231193 missense possibly damaging 0.90
R3883:Ddx42 UTSW 11 106247692 missense probably benign 0.03
R4696:Ddx42 UTSW 11 106247703 missense probably benign 0.09
R4953:Ddx42 UTSW 11 106242940 missense probably damaging 1.00
R5398:Ddx42 UTSW 11 106224898 missense probably benign
R5669:Ddx42 UTSW 11 106241819 missense probably damaging 1.00
R6091:Ddx42 UTSW 11 106234970 missense probably damaging 1.00
R6139:Ddx42 UTSW 11 106240017 missense probably damaging 1.00
R6643:Ddx42 UTSW 11 106228820 missense probably benign 0.14
R6991:Ddx42 UTSW 11 106239144 missense probably damaging 1.00
R7351:Ddx42 UTSW 11 106247682 missense probably benign
R7502:Ddx42 UTSW 11 106247739 missense probably benign 0.00
R7792:Ddx42 UTSW 11 106236996 missense probably damaging 1.00
R8145:Ddx42 UTSW 11 106240061 missense possibly damaging 0.52
R8425:Ddx42 UTSW 11 106247724 missense probably benign
RF018:Ddx42 UTSW 11 106232804 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TGTCCCCACAAACAGGAAGG -3'
(R):5'- TTTCTGATCCAACCACTTAGCAG -3'

Sequencing Primer
(F):5'- CCACAAACAGGAAGGCTTCTG -3'
(R):5'- ACCACTTAGCAGAAATAAAGATTCC -3'
Posted On2015-07-07