Incidental Mutation 'R4421:Adgrv1'
ID 327112
Institutional Source Beutler Lab
Gene Symbol Adgrv1
Ensembl Gene ENSMUSG00000069170
Gene Name adhesion G protein-coupled receptor V1
Synonyms Mass1, Mgr1, VLGR1, Gpr98
MMRRC Submission 041142-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4421 (G1)
Quality Score 225
Status Not validated
Chromosome 13
Chromosomal Location 81243187-81781273 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 81714421 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 234 (E234G)
Ref Sequence ENSEMBL: ENSMUSP00000105193 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095585] [ENSMUST00000109565] [ENSMUST00000126444]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000095585
AA Change: E954G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000093245
Gene: ENSMUSG00000069170
AA Change: E954G

DomainStartEndE-ValueType
Calx_beta 20 116 1.53e-1 SMART
Calx_beta 132 236 1.58e-2 SMART
Calx_beta 251 362 2.33e-2 SMART
Pfam:Calx-beta 380 489 1.1e-3 PFAM
Pfam:Calx-beta 507 616 2.5e-2 PFAM
Pfam:Calx-beta 667 747 9.1e-4 PFAM
Calx_beta 764 862 1.55e-1 SMART
Calx_beta 877 980 1.07e-1 SMART
Calx_beta 994 1094 6.45e-5 SMART
Pfam:Calx-beta 1108 1208 7.4e-4 PFAM
Pfam:Laminin_G_3 1331 1492 4.4e-24 PFAM
Pfam:Calx-beta 1498 1542 6.5e-3 PFAM
Pfam:Calx-beta 1557 1662 1e-6 PFAM
Calx_beta 1706 1805 1.34e-11 SMART
Calx_beta 1846 1948 1.04e-2 SMART
Calx_beta 1962 2075 1.59e-3 SMART
Calx_beta 2103 2202 1.59e-4 SMART
Calx_beta 2218 2320 1.74e-3 SMART
Pfam:Calx-beta 2467 2539 2.1e-4 PFAM
Calx_beta 2576 2672 1.24e-6 SMART
Calx_beta 2687 2786 1.12e-1 SMART
Calx_beta 2810 2921 2.21e-2 SMART
Calx_beta 2945 3044 6.69e-12 SMART
Pfam:Calx-beta 3063 3168 1.2e-5 PFAM
Pfam:Calx-beta 3198 3252 1.2e-1 PFAM
Pfam:EPTP 3391 3434 2.8e-10 PFAM
Pfam:Calx-beta 3577 3623 6.5e-8 PFAM
Pfam:Calx-beta 3637 3737 6e-4 PFAM
Pfam:Calx-beta 3781 3872 6.9e-3 PFAM
Calx_beta 3919 4003 1.18e-2 SMART
Calx_beta 4017 4120 5.44e-2 SMART
Pfam:Calx-beta 4193 4236 2.3e-2 PFAM
Calx_beta 4251 4351 1.43e-20 SMART
Calx_beta 4384 4484 9.46e-3 SMART
Pfam:Calx-beta 4498 4608 2e-2 PFAM
Pfam:Calx-beta 4659 4729 5.1e-2 PFAM
Calx_beta 4989 5089 5.7e-6 SMART
Pfam:Calx-beta 5229 5326 1.9e-6 PFAM
Pfam:Calx-beta 5489 5592 7.2e-5 PFAM
low complexity region 5637 5648 N/A INTRINSIC
GPS 5845 5895 9.48e-3 SMART
Pfam:7tm_2 5902 6141 2.3e-16 PFAM
low complexity region 6227 6240 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109565
AA Change: E234G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105193
Gene: ENSMUSG00000069170
AA Change: E234G

DomainStartEndE-ValueType
Calx_beta 44 142 1.55e-1 SMART
Calx_beta 157 260 1.07e-1 SMART
Calx_beta 274 374 6.45e-5 SMART
Pfam:Calx-beta 388 488 4.8e-4 PFAM
Pfam:Laminin_G_3 611 772 3.4e-24 PFAM
Pfam:Calx-beta 778 822 4.4e-3 PFAM
Pfam:Calx-beta 837 942 6.6e-7 PFAM
Calx_beta 986 1085 1.34e-11 SMART
Calx_beta 1126 1228 1.04e-2 SMART
Calx_beta 1242 1355 1.59e-3 SMART
Calx_beta 1383 1482 1.59e-4 SMART
Calx_beta 1498 1600 1.74e-3 SMART
Pfam:Calx-beta 1747 1819 1.4e-4 PFAM
Calx_beta 1856 1952 1.24e-6 SMART
Calx_beta 1967 2066 1.12e-1 SMART
Calx_beta 2090 2201 2.21e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000126444
AA Change: E954G

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000123552
Gene: ENSMUSG00000069170
AA Change: E954G

DomainStartEndE-ValueType
Blast:Calx_beta 20 116 1e-56 BLAST
Pfam:Calx-beta 132 236 7.6e-11 PFAM
Pfam:Calx-beta 250 362 7.9e-9 PFAM
Blast:Calx_beta 378 489 9e-6 BLAST
low complexity region 531 550 N/A INTRINSIC
Blast:Calx_beta 764 862 2e-59 BLAST
Blast:Calx_beta 877 980 1e-63 BLAST
Pfam:Calx-beta 994 1094 2.1e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156627
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the G-protein coupled receptor superfamily. The encoded protein contains a 7-transmembrane receptor domain, binds calcium and is expressed in the central nervous system. Mutations in this gene are associated with Usher syndrome 2 and familial febrile seizures. Several alternatively spliced transcripts have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a spontaneous and a targeted mutation exhibit high sensitivity to audiogenic seizures. Targeted mutant mice lack the ankle links that connect growing stereocilia in the developing cochlear hair cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acy1 G C 9: 106,312,912 (GRCm39) probably null Het
Aga T C 8: 53,964,861 (GRCm39) S8P probably benign Het
C1s2 T C 6: 124,602,174 (GRCm39) D673G probably benign Het
Capza3 G A 6: 139,987,768 (GRCm39) M122I probably benign Het
Cfap44 T C 16: 44,242,800 (GRCm39) S735P probably damaging Het
Cntn3 A G 6: 102,441,508 (GRCm39) F13L probably damaging Het
Col6a5 A T 9: 105,805,672 (GRCm39) M1078K unknown Het
Colgalt2 A T 1: 152,360,763 (GRCm39) I267F probably damaging Het
Cpped1 T C 16: 11,623,221 (GRCm39) *299W probably null Het
Cyp3a59 A G 5: 146,041,713 (GRCm39) probably null Het
Ddx42 T A 11: 106,121,964 (GRCm39) Y160N probably damaging Het
Dhx35 A T 2: 158,648,321 (GRCm39) R60W probably damaging Het
Gbp10 T C 5: 105,372,517 (GRCm39) probably null Het
Gtf2i T C 5: 134,283,891 (GRCm39) T467A possibly damaging Het
Hip1r G C 5: 124,135,925 (GRCm39) G542A possibly damaging Het
Hspg2 G A 4: 137,275,433 (GRCm39) A2748T probably benign Het
Kcnq3 T C 15: 65,867,360 (GRCm39) Y761C probably benign Het
Krt13 T G 11: 100,009,761 (GRCm39) T340P possibly damaging Het
Map2k5 A G 9: 63,071,412 (GRCm39) C435R probably damaging Het
Ms4a4c T A 19: 11,393,739 (GRCm39) I53K probably damaging Het
Myh15 T A 16: 48,929,707 (GRCm39) F544L probably damaging Het
Neurod2 G T 11: 98,219,026 (GRCm39) S46* probably null Het
Nsd3 T A 8: 26,131,288 (GRCm39) S218T probably damaging Het
Or2ag2 G T 7: 106,485,660 (GRCm39) D121E probably damaging Het
Or4p22 A T 2: 88,317,585 (GRCm39) N170Y probably damaging Het
Prrc2c TTGCTGCTGCTGCTGCTGCTGCTGCTGC TTGCTGCTGCTGCTGCTGCTGCTGC 1: 162,536,630 (GRCm39) probably benign Het
Prrg3 A T X: 71,010,915 (GRCm39) S141C probably damaging Het
Ranbp17 A T 11: 33,425,056 (GRCm39) D433E probably benign Het
Rbm28 T C 6: 29,154,836 (GRCm39) D278G probably damaging Het
Sbpl A G 17: 24,173,860 (GRCm39) L8P unknown Het
Spopl C T 2: 23,407,957 (GRCm39) V241M probably damaging Het
Tdrd3 A G 14: 87,723,719 (GRCm39) E311G probably damaging Het
Tma16 C T 8: 66,936,823 (GRCm39) probably null Het
Ubr4 A G 4: 139,189,167 (GRCm39) N3917D possibly damaging Het
Vmn2r68 TCC TC 7: 84,870,758 (GRCm39) probably null Het
Vmn2r72 T C 7: 85,387,708 (GRCm39) N619D probably damaging Het
Xab2 C A 8: 3,664,244 (GRCm39) probably null Het
Other mutations in Adgrv1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Adgrv1 APN 13 81,553,527 (GRCm39) critical splice acceptor site probably null
IGL00090:Adgrv1 APN 13 81,726,220 (GRCm39) missense probably damaging 1.00
IGL00091:Adgrv1 APN 13 81,726,220 (GRCm39) missense probably damaging 1.00
IGL00332:Adgrv1 APN 13 81,620,996 (GRCm39) splice site probably benign
IGL00471:Adgrv1 APN 13 81,657,661 (GRCm39) missense probably damaging 0.99
IGL00476:Adgrv1 APN 13 81,637,193 (GRCm39) missense probably damaging 0.98
IGL00508:Adgrv1 APN 13 81,654,306 (GRCm39) missense probably damaging 1.00
IGL00727:Adgrv1 APN 13 81,672,803 (GRCm39) missense probably damaging 0.98
IGL00781:Adgrv1 APN 13 81,726,349 (GRCm39) missense probably benign 0.19
IGL00816:Adgrv1 APN 13 81,545,322 (GRCm39) missense probably benign 0.01
IGL00844:Adgrv1 APN 13 81,688,238 (GRCm39) missense probably damaging 1.00
IGL00923:Adgrv1 APN 13 81,530,410 (GRCm39) missense probably damaging 0.99
IGL01113:Adgrv1 APN 13 81,637,147 (GRCm39) missense probably benign 0.00
IGL01143:Adgrv1 APN 13 81,567,470 (GRCm39) missense probably benign 0.00
IGL01151:Adgrv1 APN 13 81,553,518 (GRCm39) missense probably benign 0.00
IGL01153:Adgrv1 APN 13 81,567,247 (GRCm39) missense probably benign 0.01
IGL01363:Adgrv1 APN 13 81,705,184 (GRCm39) missense probably damaging 1.00
IGL01419:Adgrv1 APN 13 81,705,277 (GRCm39) missense probably damaging 0.99
IGL01545:Adgrv1 APN 13 81,614,303 (GRCm39) missense possibly damaging 0.46
IGL01701:Adgrv1 APN 13 81,567,750 (GRCm39) missense possibly damaging 0.55
IGL01796:Adgrv1 APN 13 81,715,461 (GRCm39) missense probably benign 0.01
IGL01816:Adgrv1 APN 13 81,677,168 (GRCm39) missense probably benign 0.00
IGL01871:Adgrv1 APN 13 81,620,513 (GRCm39) critical splice donor site probably null
IGL01955:Adgrv1 APN 13 81,330,902 (GRCm39) missense probably damaging 1.00
IGL01956:Adgrv1 APN 13 81,594,549 (GRCm39) missense possibly damaging 0.63
IGL01988:Adgrv1 APN 13 81,705,428 (GRCm39) missense probably damaging 0.99
IGL01990:Adgrv1 APN 13 81,705,115 (GRCm39) missense probably damaging 1.00
IGL02007:Adgrv1 APN 13 81,716,862 (GRCm39) splice site probably benign
IGL02016:Adgrv1 APN 13 81,545,572 (GRCm39) missense probably damaging 1.00
IGL02095:Adgrv1 APN 13 81,727,909 (GRCm39) missense possibly damaging 0.63
IGL02174:Adgrv1 APN 13 81,575,783 (GRCm39) missense probably benign 0.34
IGL02270:Adgrv1 APN 13 81,707,314 (GRCm39) splice site probably null
IGL02328:Adgrv1 APN 13 81,726,294 (GRCm39) missense probably damaging 1.00
IGL02350:Adgrv1 APN 13 81,418,974 (GRCm39) missense probably benign 0.00
IGL02357:Adgrv1 APN 13 81,418,974 (GRCm39) missense probably benign 0.00
IGL02373:Adgrv1 APN 13 81,607,832 (GRCm39) missense possibly damaging 0.90
IGL02402:Adgrv1 APN 13 81,707,543 (GRCm39) missense probably benign 0.18
IGL02407:Adgrv1 APN 13 81,627,789 (GRCm39) missense probably damaging 1.00
IGL02508:Adgrv1 APN 13 81,583,675 (GRCm39) splice site probably benign
IGL02603:Adgrv1 APN 13 81,637,071 (GRCm39) missense possibly damaging 0.93
IGL02648:Adgrv1 APN 13 81,659,738 (GRCm39) missense probably benign 0.35
IGL02720:Adgrv1 APN 13 81,726,991 (GRCm39) missense probably damaging 0.99
IGL02870:Adgrv1 APN 13 81,711,851 (GRCm39) missense probably benign 0.13
IGL02896:Adgrv1 APN 13 81,668,858 (GRCm39) missense probably damaging 1.00
IGL02931:Adgrv1 APN 13 81,727,833 (GRCm39) missense probably damaging 1.00
IGL02952:Adgrv1 APN 13 81,581,755 (GRCm39) missense probably benign 0.00
IGL02961:Adgrv1 APN 13 81,671,731 (GRCm39) missense probably damaging 1.00
IGL02999:Adgrv1 APN 13 81,726,973 (GRCm39) missense probably benign 0.12
IGL03067:Adgrv1 APN 13 81,590,599 (GRCm39) missense probably damaging 1.00
IGL03106:Adgrv1 APN 13 81,621,018 (GRCm39) missense probably benign 0.00
IGL03108:Adgrv1 APN 13 81,707,648 (GRCm39) missense probably damaging 1.00
IGL03119:Adgrv1 APN 13 81,581,819 (GRCm39) missense probably benign 0.02
IGL03119:Adgrv1 APN 13 81,530,492 (GRCm39) missense probably damaging 1.00
IGL03169:Adgrv1 APN 13 81,652,019 (GRCm39) missense probably damaging 1.00
IGL03186:Adgrv1 APN 13 81,581,737 (GRCm39) missense possibly damaging 0.80
IGL03196:Adgrv1 APN 13 81,594,597 (GRCm39) missense probably benign 0.02
IGL03207:Adgrv1 APN 13 81,255,017 (GRCm39) splice site probably null
IGL03343:Adgrv1 APN 13 81,431,507 (GRCm39) missense probably damaging 1.00
IGL03348:Adgrv1 APN 13 81,647,177 (GRCm39) missense possibly damaging 0.54
IGL03349:Adgrv1 APN 13 81,629,455 (GRCm39) missense probably benign 0.09
IGL03373:Adgrv1 APN 13 81,711,751 (GRCm39) missense probably damaging 0.99
IGL03381:Adgrv1 APN 13 81,666,086 (GRCm39) missense probably damaging 0.99
abetting UTSW 13 81,727,679 (GRCm39) missense probably damaging 1.00
beatle UTSW 13 81,727,713 (GRCm39) nonsense probably null
Escape UTSW 13 81,583,824 (GRCm39) missense probably benign 0.02
lento UTSW 13 81,419,016 (GRCm39) missense probably damaging 1.00
Metronome UTSW 13 81,583,678 (GRCm39) critical splice donor site probably null
Murderous UTSW 13 81,251,443 (GRCm39) missense possibly damaging 0.94
Nome UTSW 13 81,539,886 (GRCm39) missense probably benign 0.00
Propulsion UTSW 13 81,623,166 (GRCm39) missense probably benign 0.06
revulsion UTSW 13 81,743,301 (GRCm39) missense probably damaging 1.00
Saturnv UTSW 13 81,679,795 (GRCm39) missense probably damaging 1.00
Thrust UTSW 13 81,522,375 (GRCm39) missense probably benign 0.01
Velocity UTSW 13 81,545,473 (GRCm39) missense probably benign 0.00
Wilting UTSW 13 81,640,620 (GRCm39) missense probably benign 0.02
Withering UTSW 13 81,642,776 (GRCm39) missense probably damaging 1.00
F2404:Adgrv1 UTSW 13 81,568,125 (GRCm39) missense probably benign 0.13
G1patch:Adgrv1 UTSW 13 81,641,329 (GRCm39) missense probably damaging 1.00
G1patch:Adgrv1 UTSW 13 81,585,676 (GRCm39) missense probably damaging 0.99
I2288:Adgrv1 UTSW 13 81,585,643 (GRCm39) missense probably damaging 1.00
I2289:Adgrv1 UTSW 13 81,585,643 (GRCm39) missense probably damaging 1.00
PIT4377001:Adgrv1 UTSW 13 81,677,104 (GRCm39) missense probably damaging 1.00
PIT4504001:Adgrv1 UTSW 13 81,707,471 (GRCm39) missense probably damaging 0.99
R0017:Adgrv1 UTSW 13 81,727,065 (GRCm39) missense probably benign 0.13
R0017:Adgrv1 UTSW 13 81,727,065 (GRCm39) missense probably benign 0.13
R0058:Adgrv1 UTSW 13 81,330,791 (GRCm39) missense possibly damaging 0.65
R0058:Adgrv1 UTSW 13 81,330,791 (GRCm39) missense possibly damaging 0.65
R0083:Adgrv1 UTSW 13 81,726,523 (GRCm39) unclassified probably benign
R0087:Adgrv1 UTSW 13 81,535,070 (GRCm39) missense probably damaging 1.00
R0108:Adgrv1 UTSW 13 81,726,523 (GRCm39) unclassified probably benign
R0131:Adgrv1 UTSW 13 81,651,114 (GRCm39) unclassified probably benign
R0218:Adgrv1 UTSW 13 81,255,017 (GRCm39) splice site probably null
R0325:Adgrv1 UTSW 13 81,688,134 (GRCm39) missense probably damaging 1.00
R0326:Adgrv1 UTSW 13 81,623,112 (GRCm39) missense possibly damaging 0.46
R0395:Adgrv1 UTSW 13 81,534,072 (GRCm39) missense probably benign 0.00
R0441:Adgrv1 UTSW 13 81,545,345 (GRCm39) nonsense probably null
R0466:Adgrv1 UTSW 13 81,714,415 (GRCm39) missense probably benign 0.00
R0487:Adgrv1 UTSW 13 81,637,154 (GRCm39) missense probably damaging 1.00
R0501:Adgrv1 UTSW 13 81,707,269 (GRCm39) missense probably damaging 1.00
R0522:Adgrv1 UTSW 13 81,676,561 (GRCm39) splice site probably benign
R0532:Adgrv1 UTSW 13 81,727,015 (GRCm39) missense probably damaging 1.00
R0542:Adgrv1 UTSW 13 81,721,437 (GRCm39) missense probably damaging 1.00
R0681:Adgrv1 UTSW 13 81,676,649 (GRCm39) missense probably damaging 1.00
R0689:Adgrv1 UTSW 13 81,623,224 (GRCm39) missense possibly damaging 0.47
R0732:Adgrv1 UTSW 13 81,651,123 (GRCm39) missense possibly damaging 0.86
R0746:Adgrv1 UTSW 13 81,718,675 (GRCm39) missense probably benign 0.10
R0763:Adgrv1 UTSW 13 81,647,244 (GRCm39) missense probably damaging 0.98
R0846:Adgrv1 UTSW 13 81,627,861 (GRCm39) nonsense probably null
R0962:Adgrv1 UTSW 13 81,553,465 (GRCm39) missense probably benign 0.01
R1146:Adgrv1 UTSW 13 81,679,795 (GRCm39) missense probably damaging 1.00
R1146:Adgrv1 UTSW 13 81,679,795 (GRCm39) missense probably damaging 1.00
R1172:Adgrv1 UTSW 13 81,705,182 (GRCm39) missense probably damaging 0.98
R1178:Adgrv1 UTSW 13 81,588,156 (GRCm39) splice site probably benign
R1310:Adgrv1 UTSW 13 81,714,496 (GRCm39) missense probably benign 0.09
R1386:Adgrv1 UTSW 13 81,676,984 (GRCm39) missense probably benign 0.17
R1387:Adgrv1 UTSW 13 81,641,295 (GRCm39) missense possibly damaging 0.62
R1395:Adgrv1 UTSW 13 81,534,907 (GRCm39) missense probably benign 0.05
R1412:Adgrv1 UTSW 13 81,243,569 (GRCm39) missense probably damaging 1.00
R1448:Adgrv1 UTSW 13 81,581,632 (GRCm39) missense probably benign 0.08
R1470:Adgrv1 UTSW 13 81,530,417 (GRCm39) missense probably benign 0.03
R1470:Adgrv1 UTSW 13 81,530,417 (GRCm39) missense probably benign 0.03
R1485:Adgrv1 UTSW 13 81,727,738 (GRCm39) missense probably damaging 1.00
R1507:Adgrv1 UTSW 13 81,620,699 (GRCm39) critical splice acceptor site probably null
R1513:Adgrv1 UTSW 13 81,705,076 (GRCm39) missense probably damaging 1.00
R1513:Adgrv1 UTSW 13 81,741,167 (GRCm39) missense probably damaging 1.00
R1539:Adgrv1 UTSW 13 81,652,097 (GRCm39) splice site probably null
R1579:Adgrv1 UTSW 13 81,711,898 (GRCm39) missense probably damaging 1.00
R1580:Adgrv1 UTSW 13 81,614,279 (GRCm39) critical splice donor site probably null
R1611:Adgrv1 UTSW 13 81,707,236 (GRCm39) missense probably damaging 1.00
R1615:Adgrv1 UTSW 13 81,572,407 (GRCm39) missense probably benign 0.41
R1651:Adgrv1 UTSW 13 81,635,972 (GRCm39) missense probably benign 0.19
R1660:Adgrv1 UTSW 13 81,624,750 (GRCm39) missense probably benign 0.00
R1679:Adgrv1 UTSW 13 81,707,671 (GRCm39) missense probably damaging 1.00
R1709:Adgrv1 UTSW 13 81,741,179 (GRCm39) missense probably damaging 1.00
R1735:Adgrv1 UTSW 13 81,636,066 (GRCm39) missense possibly damaging 0.62
R1762:Adgrv1 UTSW 13 81,654,265 (GRCm39) missense probably benign 0.08
R1830:Adgrv1 UTSW 13 81,637,196 (GRCm39) missense possibly damaging 0.65
R1836:Adgrv1 UTSW 13 81,652,232 (GRCm39) missense probably benign 0.01
R1843:Adgrv1 UTSW 13 81,692,652 (GRCm39) missense probably damaging 1.00
R1863:Adgrv1 UTSW 13 81,711,685 (GRCm39) missense probably damaging 1.00
R1895:Adgrv1 UTSW 13 81,522,368 (GRCm39) missense probably damaging 1.00
R1907:Adgrv1 UTSW 13 81,740,670 (GRCm39) splice site probably benign
R1928:Adgrv1 UTSW 13 81,668,905 (GRCm39) missense probably benign 0.00
R1938:Adgrv1 UTSW 13 81,539,876 (GRCm39) missense probably damaging 0.99
R1944:Adgrv1 UTSW 13 81,659,030 (GRCm39) missense probably damaging 1.00
R1946:Adgrv1 UTSW 13 81,522,368 (GRCm39) missense probably damaging 1.00
R1984:Adgrv1 UTSW 13 81,671,868 (GRCm39) missense probably damaging 1.00
R2027:Adgrv1 UTSW 13 81,743,301 (GRCm39) missense probably damaging 1.00
R2063:Adgrv1 UTSW 13 81,709,588 (GRCm39) missense possibly damaging 0.81
R2116:Adgrv1 UTSW 13 81,677,132 (GRCm39) missense probably benign 0.11
R2117:Adgrv1 UTSW 13 81,640,656 (GRCm39) missense probably benign 0.00
R2125:Adgrv1 UTSW 13 81,568,069 (GRCm39) missense probably benign 0.02
R2125:Adgrv1 UTSW 13 81,567,654 (GRCm39) missense probably benign 0.00
R2127:Adgrv1 UTSW 13 81,705,199 (GRCm39) missense probably damaging 1.00
R2128:Adgrv1 UTSW 13 81,705,199 (GRCm39) missense probably damaging 1.00
R2129:Adgrv1 UTSW 13 81,705,199 (GRCm39) missense probably damaging 1.00
R2130:Adgrv1 UTSW 13 81,729,846 (GRCm39) missense possibly damaging 0.61
R2135:Adgrv1 UTSW 13 81,672,676 (GRCm39) critical splice donor site probably null
R2138:Adgrv1 UTSW 13 81,593,439 (GRCm39) missense probably benign 0.00
R2166:Adgrv1 UTSW 13 81,716,762 (GRCm39) missense probably damaging 1.00
R2171:Adgrv1 UTSW 13 81,419,037 (GRCm39) missense probably damaging 1.00
R2191:Adgrv1 UTSW 13 81,714,409 (GRCm39) missense possibly damaging 0.90
R2256:Adgrv1 UTSW 13 81,654,259 (GRCm39) missense probably benign
R2260:Adgrv1 UTSW 13 81,716,493 (GRCm39) missense probably damaging 0.97
R2323:Adgrv1 UTSW 13 81,743,298 (GRCm39) missense probably damaging 1.00
R2432:Adgrv1 UTSW 13 81,688,251 (GRCm39) frame shift probably null
R2910:Adgrv1 UTSW 13 81,705,238 (GRCm39) missense possibly damaging 0.61
R2920:Adgrv1 UTSW 13 81,596,984 (GRCm39) missense probably benign 0.01
R2989:Adgrv1 UTSW 13 81,729,866 (GRCm39) missense probably damaging 1.00
R3402:Adgrv1 UTSW 13 81,691,661 (GRCm39) missense probably damaging 1.00
R3692:Adgrv1 UTSW 13 81,672,719 (GRCm39) missense possibly damaging 0.91
R3711:Adgrv1 UTSW 13 81,567,594 (GRCm39) missense probably benign 0.02
R3732:Adgrv1 UTSW 13 81,705,075 (GRCm39) missense probably damaging 1.00
R3732:Adgrv1 UTSW 13 81,705,075 (GRCm39) missense probably damaging 1.00
R3733:Adgrv1 UTSW 13 81,705,075 (GRCm39) missense probably damaging 1.00
R3773:Adgrv1 UTSW 13 81,647,162 (GRCm39) missense probably damaging 0.98
R3791:Adgrv1 UTSW 13 81,741,221 (GRCm39) missense probably damaging 1.00
R3794:Adgrv1 UTSW 13 81,431,486 (GRCm39) start codon destroyed probably damaging 1.00
R3848:Adgrv1 UTSW 13 81,588,191 (GRCm39) missense probably damaging 0.97
R3880:Adgrv1 UTSW 13 81,583,824 (GRCm39) missense probably benign 0.02
R3925:Adgrv1 UTSW 13 81,726,891 (GRCm39) missense possibly damaging 0.89
R3934:Adgrv1 UTSW 13 81,623,166 (GRCm39) missense probably benign 0.06
R3942:Adgrv1 UTSW 13 81,330,908 (GRCm39) missense probably damaging 1.00
R4002:Adgrv1 UTSW 13 81,688,251 (GRCm39) frame shift probably null
R4003:Adgrv1 UTSW 13 81,688,251 (GRCm39) frame shift probably null
R4194:Adgrv1 UTSW 13 81,647,115 (GRCm39) missense probably damaging 0.98
R4308:Adgrv1 UTSW 13 81,588,311 (GRCm39) missense probably damaging 0.96
R4368:Adgrv1 UTSW 13 81,641,029 (GRCm39) missense unknown
R4388:Adgrv1 UTSW 13 81,729,828 (GRCm39) missense probably damaging 0.98
R4468:Adgrv1 UTSW 13 81,522,375 (GRCm39) missense probably benign 0.01
R4483:Adgrv1 UTSW 13 81,567,349 (GRCm39) missense probably benign 0.01
R4487:Adgrv1 UTSW 13 81,588,185 (GRCm39) missense probably damaging 0.99
R4566:Adgrv1 UTSW 13 81,567,927 (GRCm39) missense probably damaging 1.00
R4615:Adgrv1 UTSW 13 81,642,688 (GRCm39) splice site probably null
R4647:Adgrv1 UTSW 13 81,676,914 (GRCm39) nonsense probably null
R4657:Adgrv1 UTSW 13 81,553,483 (GRCm39) missense probably benign 0.01
R4723:Adgrv1 UTSW 13 81,581,644 (GRCm39) missense probably benign 0.02
R4765:Adgrv1 UTSW 13 81,255,038 (GRCm39) missense probably damaging 0.99
R4783:Adgrv1 UTSW 13 81,243,564 (GRCm39) missense probably damaging 0.99
R4796:Adgrv1 UTSW 13 81,303,350 (GRCm39) nonsense probably null
R4816:Adgrv1 UTSW 13 81,676,793 (GRCm39) missense probably damaging 1.00
R4833:Adgrv1 UTSW 13 81,708,963 (GRCm39) missense possibly damaging 0.81
R4841:Adgrv1 UTSW 13 81,651,120 (GRCm39) critical splice donor site probably null
R4871:Adgrv1 UTSW 13 81,681,241 (GRCm39) intron probably benign
R4897:Adgrv1 UTSW 13 81,709,704 (GRCm39) splice site probably null
R4906:Adgrv1 UTSW 13 81,418,857 (GRCm39) splice site probably null
R4917:Adgrv1 UTSW 13 81,658,996 (GRCm39) missense probably benign 0.30
R4996:Adgrv1 UTSW 13 81,726,853 (GRCm39) missense probably benign 0.01
R5030:Adgrv1 UTSW 13 81,607,948 (GRCm39) missense probably benign 0.43
R5044:Adgrv1 UTSW 13 81,637,050 (GRCm39) missense probably benign 0.01
R5052:Adgrv1 UTSW 13 81,676,940 (GRCm39) missense probably damaging 0.97
R5093:Adgrv1 UTSW 13 81,740,704 (GRCm39) missense probably damaging 1.00
R5095:Adgrv1 UTSW 13 81,243,606 (GRCm39) missense probably benign 0.00
R5119:Adgrv1 UTSW 13 81,567,546 (GRCm39) missense possibly damaging 0.93
R5133:Adgrv1 UTSW 13 81,587,560 (GRCm39) missense probably damaging 1.00
R5141:Adgrv1 UTSW 13 81,419,037 (GRCm39) missense probably damaging 1.00
R5164:Adgrv1 UTSW 13 81,583,793 (GRCm39) missense probably benign 0.00
R5180:Adgrv1 UTSW 13 81,431,535 (GRCm39) start gained probably benign
R5203:Adgrv1 UTSW 13 81,659,024 (GRCm39) missense possibly damaging 0.91
R5241:Adgrv1 UTSW 13 81,637,048 (GRCm39) nonsense probably null
R5280:Adgrv1 UTSW 13 81,545,584 (GRCm39) missense possibly damaging 0.95
R5289:Adgrv1 UTSW 13 81,669,203 (GRCm39) missense probably benign 0.04
R5304:Adgrv1 UTSW 13 81,726,372 (GRCm39) missense possibly damaging 0.93
R5310:Adgrv1 UTSW 13 81,624,809 (GRCm39) missense possibly damaging 0.95
R5338:Adgrv1 UTSW 13 81,677,165 (GRCm39) missense possibly damaging 0.80
R5352:Adgrv1 UTSW 13 81,642,776 (GRCm39) missense probably damaging 1.00
R5402:Adgrv1 UTSW 13 81,607,834 (GRCm39) missense probably benign 0.25
R5418:Adgrv1 UTSW 13 81,567,427 (GRCm39) missense probably benign 0.01
R5460:Adgrv1 UTSW 13 81,572,377 (GRCm39) missense possibly damaging 0.95
R5510:Adgrv1 UTSW 13 81,593,363 (GRCm39) missense probably damaging 1.00
R5521:Adgrv1 UTSW 13 81,567,508 (GRCm39) missense probably benign 0.01
R5538:Adgrv1 UTSW 13 81,581,808 (GRCm39) missense probably benign 0.02
R5561:Adgrv1 UTSW 13 81,624,683 (GRCm39) missense probably damaging 0.99
R5584:Adgrv1 UTSW 13 81,553,386 (GRCm39) missense probably damaging 1.00
R5608:Adgrv1 UTSW 13 81,303,395 (GRCm39) missense probably damaging 1.00
R5610:Adgrv1 UTSW 13 81,669,236 (GRCm39) missense probably damaging 1.00
R5619:Adgrv1 UTSW 13 81,620,619 (GRCm39) missense probably damaging 1.00
R5751:Adgrv1 UTSW 13 81,670,355 (GRCm39) missense probably damaging 1.00
R5832:Adgrv1 UTSW 13 81,251,421 (GRCm39) missense possibly damaging 0.95
R5885:Adgrv1 UTSW 13 81,572,390 (GRCm39) missense probably benign 0.15
R5930:Adgrv1 UTSW 13 81,545,570 (GRCm39) missense probably benign 0.06
R5937:Adgrv1 UTSW 13 81,255,194 (GRCm39) missense probably damaging 0.96
R5943:Adgrv1 UTSW 13 81,534,985 (GRCm39) missense probably damaging 0.98
R5951:Adgrv1 UTSW 13 81,590,620 (GRCm39) missense probably damaging 1.00
R5977:Adgrv1 UTSW 13 81,583,678 (GRCm39) critical splice donor site probably null
R5995:Adgrv1 UTSW 13 81,614,378 (GRCm39) missense probably benign 0.03
R6017:Adgrv1 UTSW 13 81,545,542 (GRCm39) nonsense probably null
R6024:Adgrv1 UTSW 13 81,624,624 (GRCm39) missense probably benign 0.26
R6049:Adgrv1 UTSW 13 81,545,473 (GRCm39) missense probably benign 0.00
R6108:Adgrv1 UTSW 13 81,539,814 (GRCm39) missense probably damaging 0.99
R6130:Adgrv1 UTSW 13 81,575,864 (GRCm39) missense probably damaging 0.99
R6132:Adgrv1 UTSW 13 81,654,195 (GRCm39) missense probably benign 0.04
R6149:Adgrv1 UTSW 13 81,330,893 (GRCm39) missense probably damaging 1.00
R6169:Adgrv1 UTSW 13 81,567,378 (GRCm39) missense probably benign 0.00
R6175:Adgrv1 UTSW 13 81,534,124 (GRCm39) missense probably damaging 1.00
R6184:Adgrv1 UTSW 13 81,581,957 (GRCm39) missense probably benign 0.01
R6190:Adgrv1 UTSW 13 81,672,898 (GRCm39) splice site probably null
R6190:Adgrv1 UTSW 13 81,607,882 (GRCm39) splice site probably null
R6215:Adgrv1 UTSW 13 81,727,713 (GRCm39) nonsense probably null
R6216:Adgrv1 UTSW 13 81,672,590 (GRCm39) splice site probably null
R6238:Adgrv1 UTSW 13 81,614,402 (GRCm39) missense probably benign 0.07
R6244:Adgrv1 UTSW 13 81,255,050 (GRCm39) missense probably damaging 1.00
R6298:Adgrv1 UTSW 13 81,539,886 (GRCm39) missense probably benign 0.00
R6316:Adgrv1 UTSW 13 81,647,187 (GRCm39) missense possibly damaging 0.63
R6336:Adgrv1 UTSW 13 81,534,100 (GRCm39) missense probably benign 0.09
R6358:Adgrv1 UTSW 13 81,562,702 (GRCm39) missense probably damaging 0.99
R6421:Adgrv1 UTSW 13 81,656,855 (GRCm39) missense possibly damaging 0.69
R6466:Adgrv1 UTSW 13 81,723,220 (GRCm39) splice site probably null
R6467:Adgrv1 UTSW 13 81,592,657 (GRCm39) missense probably benign 0.01
R6510:Adgrv1 UTSW 13 81,707,609 (GRCm39) missense possibly damaging 0.88
R6519:Adgrv1 UTSW 13 81,715,462 (GRCm39) missense probably benign 0.01
R6521:Adgrv1 UTSW 13 81,581,771 (GRCm39) missense probably damaging 1.00
R6598:Adgrv1 UTSW 13 81,654,298 (GRCm39) missense probably damaging 1.00
R6605:Adgrv1 UTSW 13 81,636,081 (GRCm39) missense possibly damaging 0.80
R6626:Adgrv1 UTSW 13 81,666,245 (GRCm39) missense probably damaging 1.00
R6633:Adgrv1 UTSW 13 81,716,762 (GRCm39) missense probably damaging 1.00
R6721:Adgrv1 UTSW 13 81,629,634 (GRCm39) missense probably benign 0.00
R6725:Adgrv1 UTSW 13 81,585,676 (GRCm39) missense probably damaging 0.99
R6725:Adgrv1 UTSW 13 81,641,329 (GRCm39) missense probably damaging 1.00
R6796:Adgrv1 UTSW 13 81,620,597 (GRCm39) missense probably damaging 1.00
R6809:Adgrv1 UTSW 13 81,621,072 (GRCm39) missense probably benign 0.01
R6823:Adgrv1 UTSW 13 81,705,200 (GRCm39) missense probably damaging 1.00
R6876:Adgrv1 UTSW 13 81,303,273 (GRCm39) critical splice donor site probably null
R6878:Adgrv1 UTSW 13 81,581,613 (GRCm39) missense probably benign 0.06
R6887:Adgrv1 UTSW 13 81,676,820 (GRCm39) missense probably benign 0.01
R6888:Adgrv1 UTSW 13 81,656,788 (GRCm39) missense probably damaging 1.00
R6957:Adgrv1 UTSW 13 81,715,609 (GRCm39) missense probably benign 0.00
R6976:Adgrv1 UTSW 13 81,669,116 (GRCm39) missense probably damaging 1.00
R7003:Adgrv1 UTSW 13 81,670,223 (GRCm39) critical splice donor site probably null
R7007:Adgrv1 UTSW 13 81,684,483 (GRCm39) missense possibly damaging 0.80
R7073:Adgrv1 UTSW 13 81,709,593 (GRCm39) missense probably damaging 1.00
R7100:Adgrv1 UTSW 13 81,419,016 (GRCm39) missense probably damaging 1.00
R7107:Adgrv1 UTSW 13 81,726,261 (GRCm39) missense probably benign 0.13
R7123:Adgrv1 UTSW 13 81,740,693 (GRCm39) missense probably damaging 1.00
R7141:Adgrv1 UTSW 13 81,640,620 (GRCm39) missense probably benign 0.02
R7168:Adgrv1 UTSW 13 81,545,328 (GRCm39) missense possibly damaging 0.52
R7205:Adgrv1 UTSW 13 81,627,777 (GRCm39) missense probably benign 0.00
R7239:Adgrv1 UTSW 13 81,624,731 (GRCm39) missense possibly damaging 0.69
R7249:Adgrv1 UTSW 13 81,522,378 (GRCm39) missense probably damaging 1.00
R7313:Adgrv1 UTSW 13 81,668,634 (GRCm39) missense possibly damaging 0.95
R7376:Adgrv1 UTSW 13 81,666,245 (GRCm39) missense probably damaging 1.00
R7392:Adgrv1 UTSW 13 81,708,808 (GRCm39) missense probably damaging 1.00
R7395:Adgrv1 UTSW 13 81,707,467 (GRCm39) missense probably damaging 1.00
R7410:Adgrv1 UTSW 13 81,711,738 (GRCm39) missense probably benign 0.04
R7449:Adgrv1 UTSW 13 81,647,192 (GRCm39) missense probably damaging 0.99
R7496:Adgrv1 UTSW 13 81,588,344 (GRCm39) missense possibly damaging 0.79
R7497:Adgrv1 UTSW 13 81,588,344 (GRCm39) missense possibly damaging 0.79
R7498:Adgrv1 UTSW 13 81,588,344 (GRCm39) missense possibly damaging 0.79
R7567:Adgrv1 UTSW 13 81,727,596 (GRCm39) missense probably damaging 1.00
R7567:Adgrv1 UTSW 13 81,581,648 (GRCm39) missense probably benign 0.00
R7614:Adgrv1 UTSW 13 81,668,780 (GRCm39) missense probably damaging 1.00
R7623:Adgrv1 UTSW 13 81,570,344 (GRCm39) missense possibly damaging 0.77
R7665:Adgrv1 UTSW 13 81,647,261 (GRCm39) missense probably damaging 1.00
R7685:Adgrv1 UTSW 13 81,251,443 (GRCm39) missense possibly damaging 0.94
R7788:Adgrv1 UTSW 13 81,721,433 (GRCm39) missense probably damaging 1.00
R7809:Adgrv1 UTSW 13 81,676,760 (GRCm39) missense possibly damaging 0.81
R7854:Adgrv1 UTSW 13 81,741,207 (GRCm39) missense probably damaging 1.00
R7894:Adgrv1 UTSW 13 81,715,570 (GRCm39) missense probably benign 0.00
R7948:Adgrv1 UTSW 13 81,707,707 (GRCm39) missense probably damaging 1.00
R7948:Adgrv1 UTSW 13 81,707,648 (GRCm39) missense probably damaging 1.00
R7949:Adgrv1 UTSW 13 81,303,353 (GRCm39) missense probably damaging 1.00
R7951:Adgrv1 UTSW 13 81,711,689 (GRCm39) missense probably damaging 1.00
R7968:Adgrv1 UTSW 13 81,588,344 (GRCm39) missense possibly damaging 0.79
R7969:Adgrv1 UTSW 13 81,588,344 (GRCm39) missense possibly damaging 0.79
R7973:Adgrv1 UTSW 13 81,588,344 (GRCm39) missense possibly damaging 0.79
R8007:Adgrv1 UTSW 13 81,431,585 (GRCm39) missense probably benign 0.04
R8018:Adgrv1 UTSW 13 81,588,344 (GRCm39) missense possibly damaging 0.79
R8044:Adgrv1 UTSW 13 81,588,344 (GRCm39) missense possibly damaging 0.79
R8050:Adgrv1 UTSW 13 81,561,296 (GRCm39) missense probably damaging 1.00
R8090:Adgrv1 UTSW 13 81,596,953 (GRCm39) critical splice donor site probably null
R8104:Adgrv1 UTSW 13 81,588,344 (GRCm39) missense possibly damaging 0.79
R8122:Adgrv1 UTSW 13 81,419,037 (GRCm39) missense probably damaging 1.00
R8122:Adgrv1 UTSW 13 81,588,344 (GRCm39) missense possibly damaging 0.79
R8123:Adgrv1 UTSW 13 81,588,344 (GRCm39) missense possibly damaging 0.79
R8125:Adgrv1 UTSW 13 81,588,344 (GRCm39) missense possibly damaging 0.79
R8126:Adgrv1 UTSW 13 81,588,344 (GRCm39) missense possibly damaging 0.79
R8212:Adgrv1 UTSW 13 81,670,240 (GRCm39) missense probably benign 0.01
R8221:Adgrv1 UTSW 13 81,677,033 (GRCm39) missense probably benign 0.00
R8256:Adgrv1 UTSW 13 81,727,679 (GRCm39) missense probably damaging 1.00
R8270:Adgrv1 UTSW 13 81,651,163 (GRCm39) missense probably damaging 0.96
R8290:Adgrv1 UTSW 13 81,630,002 (GRCm39) missense probably benign 0.00
R8298:Adgrv1 UTSW 13 81,534,033 (GRCm39) nonsense probably null
R8317:Adgrv1 UTSW 13 81,723,236 (GRCm39) missense probably damaging 0.98
R8326:Adgrv1 UTSW 13 81,593,462 (GRCm39) missense probably damaging 1.00
R8327:Adgrv1 UTSW 13 81,593,462 (GRCm39) missense probably damaging 1.00
R8330:Adgrv1 UTSW 13 81,593,462 (GRCm39) missense probably damaging 1.00
R8332:Adgrv1 UTSW 13 81,593,462 (GRCm39) missense probably damaging 1.00
R8345:Adgrv1 UTSW 13 81,251,505 (GRCm39) missense probably damaging 1.00
R8398:Adgrv1 UTSW 13 81,330,797 (GRCm39) missense probably damaging 1.00
R8399:Adgrv1 UTSW 13 81,637,289 (GRCm39) missense possibly damaging 0.55
R8450:Adgrv1 UTSW 13 81,583,962 (GRCm39) splice site probably null
R8471:Adgrv1 UTSW 13 81,594,591 (GRCm39) missense probably benign 0.00
R8534:Adgrv1 UTSW 13 81,534,887 (GRCm39) missense probably benign 0.02
R8537:Adgrv1 UTSW 13 81,684,491 (GRCm39) missense probably damaging 1.00
R8703:Adgrv1 UTSW 13 81,676,792 (GRCm39) missense probably damaging 1.00
R8845:Adgrv1 UTSW 13 81,629,478 (GRCm39) missense possibly damaging 0.79
R8846:Adgrv1 UTSW 13 81,637,025 (GRCm39) critical splice donor site probably null
R8849:Adgrv1 UTSW 13 81,669,324 (GRCm39) missense probably benign
R8856:Adgrv1 UTSW 13 81,707,621 (GRCm39) missense probably benign 0.11
R8915:Adgrv1 UTSW 13 81,715,558 (GRCm39) missense probably damaging 1.00
R8963:Adgrv1 UTSW 13 81,567,588 (GRCm39) missense probably benign
R8994:Adgrv1 UTSW 13 81,553,457 (GRCm39) frame shift probably null
R8995:Adgrv1 UTSW 13 81,553,457 (GRCm39) frame shift probably null
R8996:Adgrv1 UTSW 13 81,553,457 (GRCm39) frame shift probably null
R8997:Adgrv1 UTSW 13 81,553,457 (GRCm39) frame shift probably null
R9022:Adgrv1 UTSW 13 81,303,312 (GRCm39) missense probably damaging 1.00
R9059:Adgrv1 UTSW 13 81,562,692 (GRCm39) critical splice donor site probably null
R9076:Adgrv1 UTSW 13 81,570,247 (GRCm39) critical splice donor site probably null
R9119:Adgrv1 UTSW 13 81,658,995 (GRCm39) missense probably damaging 0.97
R9137:Adgrv1 UTSW 13 81,688,133 (GRCm39) missense probably damaging 1.00
R9146:Adgrv1 UTSW 13 81,561,291 (GRCm39) missense probably benign 0.11
R9156:Adgrv1 UTSW 13 81,669,302 (GRCm39) missense probably benign 0.00
R9163:Adgrv1 UTSW 13 81,567,541 (GRCm39) missense probably benign 0.19
R9282:Adgrv1 UTSW 13 81,251,491 (GRCm39) missense probably damaging 1.00
R9286:Adgrv1 UTSW 13 81,594,520 (GRCm39) missense probably damaging 0.98
R9328:Adgrv1 UTSW 13 81,620,523 (GRCm39) missense probably damaging 1.00
R9329:Adgrv1 UTSW 13 81,647,241 (GRCm39) missense probably damaging 1.00
R9350:Adgrv1 UTSW 13 81,654,274 (GRCm39) missense probably damaging 1.00
R9377:Adgrv1 UTSW 13 81,705,277 (GRCm39) missense probably damaging 0.99
R9394:Adgrv1 UTSW 13 81,624,767 (GRCm39) missense possibly damaging 0.95
R9419:Adgrv1 UTSW 13 81,656,887 (GRCm39) missense probably benign 0.44
R9427:Adgrv1 UTSW 13 81,732,234 (GRCm39) missense probably benign 0.00
R9429:Adgrv1 UTSW 13 81,741,165 (GRCm39) missense probably damaging 0.99
R9429:Adgrv1 UTSW 13 81,567,468 (GRCm39) missense probably damaging 1.00
R9433:Adgrv1 UTSW 13 81,714,471 (GRCm39) missense probably benign 0.02
R9434:Adgrv1 UTSW 13 81,666,292 (GRCm39) splice site probably benign
R9513:Adgrv1 UTSW 13 81,530,472 (GRCm39) missense possibly damaging 0.95
R9515:Adgrv1 UTSW 13 81,691,497 (GRCm39) missense probably damaging 0.99
R9523:Adgrv1 UTSW 13 81,567,178 (GRCm39) missense
R9525:Adgrv1 UTSW 13 81,593,453 (GRCm39) missense possibly damaging 0.77
R9576:Adgrv1 UTSW 13 81,691,608 (GRCm39) missense probably benign 0.06
R9612:Adgrv1 UTSW 13 81,641,082 (GRCm39) missense probably damaging 1.00
R9664:Adgrv1 UTSW 13 81,743,371 (GRCm39) missense probably damaging 1.00
R9664:Adgrv1 UTSW 13 81,670,288 (GRCm39) missense probably benign 0.01
R9702:Adgrv1 UTSW 13 81,684,483 (GRCm39) missense possibly damaging 0.80
R9717:Adgrv1 UTSW 13 81,668,900 (GRCm39) missense probably damaging 1.00
R9720:Adgrv1 UTSW 13 81,740,693 (GRCm39) missense probably damaging 1.00
X0054:Adgrv1 UTSW 13 81,707,389 (GRCm39) missense probably damaging 1.00
X0062:Adgrv1 UTSW 13 81,535,045 (GRCm39) missense probably damaging 0.99
X0067:Adgrv1 UTSW 13 81,691,511 (GRCm39) missense possibly damaging 0.51
Z1088:Adgrv1 UTSW 13 81,624,791 (GRCm39) missense probably damaging 1.00
Z1176:Adgrv1 UTSW 13 81,707,753 (GRCm39) missense possibly damaging 0.90
Z1177:Adgrv1 UTSW 13 81,567,375 (GRCm39) missense possibly damaging 0.54
Predicted Primers PCR Primer
(F):5'- GCTTCATAACCAACTAGTCATGC -3'
(R):5'- AGAGGCATTTGATTCCTGCTTG -3'

Sequencing Primer
(F):5'- TAAGCTATAAATGTAGACTGCTTGC -3'
(R):5'- GCATTTGATTCCTGCTTGTTTTGC -3'
Posted On 2015-07-07