Incidental Mutation 'R4421:Cpped1'
ID327115
Institutional Source Beutler Lab
Gene Symbol Cpped1
Ensembl Gene ENSMUSG00000065979
Gene Namecalcineurin-like phosphoesterase domain containing 1
Synonyms
MMRRC Submission 041142-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R4421 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location11803721-11909445 bp(-) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) T to C at 11805357 bp
ZygosityHeterozygous
Amino Acid Change Stop codon to Tryptophan at position 299 (*299W)
Ref Sequence ENSEMBL: ENSMUSP00000112587 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096272] [ENSMUST00000121750]
Predicted Effect probably null
Transcript: ENSMUST00000096272
AA Change: *313W
SMART Domains Protein: ENSMUSP00000093992
Gene: ENSMUSG00000065979
AA Change: *313W

DomainStartEndE-ValueType
Pfam:Metallophos 33 250 4.6e-14 PFAM
Pfam:Metallophos_2 63 285 6e-10 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000121750
AA Change: *299W
SMART Domains Protein: ENSMUSP00000112587
Gene: ENSMUSG00000065979
AA Change: *299W

DomainStartEndE-ValueType
Pfam:Metallophos 25 236 1e-14 PFAM
Pfam:Metallophos_2 45 271 6.8e-12 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acy1 G C 9: 106,435,713 probably null Het
Adgrv1 T C 13: 81,566,302 E234G probably damaging Het
Aga T C 8: 53,511,826 S8P probably benign Het
C1s2 T C 6: 124,625,215 D673G probably benign Het
Capza3 G A 6: 140,042,042 M122I probably benign Het
Cfap44 T C 16: 44,422,437 S735P probably damaging Het
Cntn3 A G 6: 102,464,547 F13L probably damaging Het
Col6a5 A T 9: 105,928,473 M1078K unknown Het
Colgalt2 A T 1: 152,485,012 I267F probably damaging Het
Cyp3a59 A G 5: 146,104,903 probably null Het
Ddx42 T A 11: 106,231,138 Y160N probably damaging Het
Dhx35 A T 2: 158,806,401 R60W probably damaging Het
Gbp10 T C 5: 105,224,651 probably null Het
Gtf2i T C 5: 134,255,037 T467A possibly damaging Het
Hip1r G C 5: 123,997,862 G542A possibly damaging Het
Hspg2 G A 4: 137,548,122 A2748T probably benign Het
Kcnq3 T C 15: 65,995,511 Y761C probably benign Het
Krt13 T G 11: 100,118,935 T340P possibly damaging Het
Map2k5 A G 9: 63,164,130 C435R probably damaging Het
Ms4a4c T A 19: 11,416,375 I53K probably damaging Het
Myh15 T A 16: 49,109,344 F544L probably damaging Het
Neurod2 G T 11: 98,328,200 S46* probably null Het
Nsd3 T A 8: 25,641,272 S218T probably damaging Het
Olfr1184 A T 2: 88,487,241 N170Y probably damaging Het
Olfr706 G T 7: 106,886,453 D121E probably damaging Het
Prrc2c TTGCTGCTGCTGCTGCTGCTGCTGCTGC TTGCTGCTGCTGCTGCTGCTGCTGC 1: 162,709,061 probably benign Het
Prrg3 A T X: 71,967,309 S141C probably damaging Het
Ranbp17 A T 11: 33,475,056 D433E probably benign Het
Rbm28 T C 6: 29,154,837 D278G probably damaging Het
Sbpl A G 17: 23,954,886 L8P unknown Het
Spopl C T 2: 23,517,945 V241M probably damaging Het
Tdrd3 A G 14: 87,486,283 E311G probably damaging Het
Tma16 C T 8: 66,484,171 probably null Het
Ubr4 A G 4: 139,461,856 N3917D possibly damaging Het
Vmn2r68 TCC TC 7: 85,221,550 probably null Het
Vmn2r72 T C 7: 85,738,500 N619D probably damaging Het
Xab2 C A 8: 3,614,244 probably null Het
Other mutations in Cpped1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02221:Cpped1 APN 16 11828528 missense probably damaging 1.00
IGL02448:Cpped1 APN 16 11805389 missense probably benign 0.30
IGL03048:Cpped1 UTSW 16 11828475 missense probably benign 0.23
R0725:Cpped1 UTSW 16 11828450 missense probably damaging 0.97
R2084:Cpped1 UTSW 16 11828501 missense probably damaging 1.00
R2276:Cpped1 UTSW 16 11894881 critical splice donor site probably null
R3702:Cpped1 UTSW 16 11828440 missense probably damaging 1.00
R4321:Cpped1 UTSW 16 11887746 missense probably benign 0.35
R4407:Cpped1 UTSW 16 11805421 missense probably damaging 0.96
R4672:Cpped1 UTSW 16 11805374 nonsense probably null
R4704:Cpped1 UTSW 16 11885629 intron probably benign
R4928:Cpped1 UTSW 16 11828279 missense probably damaging 1.00
R5647:Cpped1 UTSW 16 11828146 unclassified probably benign
R7260:Cpped1 UTSW 16 11828463 missense possibly damaging 0.90
R7610:Cpped1 UTSW 16 11894878 splice site probably null
R8008:Cpped1 UTSW 16 11828396 missense probably damaging 1.00
X0017:Cpped1 UTSW 16 11828292 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAAGGAAAGGCAGTTCTCTTTTG -3'
(R):5'- GTATCAGAGCTGTGTTCTCCGG -3'

Sequencing Primer
(F):5'- AGGCAGTTCTCTTTTGAAATAAGGG -3'
(R):5'- GGAACCTACCAGAATCTTGACATGG -3'
Posted On2015-07-07