Incidental Mutation 'R4421:Prrg3'
ID327120
Institutional Source Beutler Lab
Gene Symbol Prrg3
Ensembl Gene ENSMUSG00000033361
Gene Nameproline rich Gla (G-carboxyglutamic acid) 3 (transmembrane)
SynonymsLOC208748
MMRRC Submission 041142-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.031) question?
Stock #R4421 (G1)
Quality Score222
Status Not validated
ChromosomeX
Chromosomal Location71962624-71972722 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 71967309 bp
ZygosityHeterozygous
Amino Acid Change Serine to Cysteine at position 141 (S141C)
Ref Sequence ENSEMBL: ENSMUSP00000128073 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048790] [ENSMUST00000126362] [ENSMUST00000170096]
Predicted Effect probably damaging
Transcript: ENSMUST00000048790
AA Change: S141C

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000038947
Gene: ENSMUSG00000033361
AA Change: S141C

DomainStartEndE-ValueType
GLA 1 64 1.25e-25 SMART
transmembrane domain 79 101 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126362
SMART Domains Protein: ENSMUSP00000118155
Gene: ENSMUSG00000033361

DomainStartEndE-ValueType
GLA 1 52 6.79e-13 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000170096
AA Change: S141C

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000128073
Gene: ENSMUSG00000033361
AA Change: S141C

DomainStartEndE-ValueType
GLA 1 64 1.25e-25 SMART
transmembrane domain 79 101 N/A INTRINSIC
Meta Mutation Damage Score 0.1059 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes proline-rich gamma-carboxyglutamic acid protein 3, a member of vitamin K-dependent membrane proteins containing gamma-carboxyglutamic acid residues. The encoded precursor protein contains an N-terminal propeptide that is required for the carboxylation of glutamate residues in the mature protein. Alternate splicing of this gene results in multiple transcript variants that encode the same protein. [provided by RefSeq, Dec 2014]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acy1 G C 9: 106,435,713 probably null Het
Adgrv1 T C 13: 81,566,302 E234G probably damaging Het
Aga T C 8: 53,511,826 S8P probably benign Het
C1s2 T C 6: 124,625,215 D673G probably benign Het
Capza3 G A 6: 140,042,042 M122I probably benign Het
Cfap44 T C 16: 44,422,437 S735P probably damaging Het
Cntn3 A G 6: 102,464,547 F13L probably damaging Het
Col6a5 A T 9: 105,928,473 M1078K unknown Het
Colgalt2 A T 1: 152,485,012 I267F probably damaging Het
Cpped1 T C 16: 11,805,357 *299W probably null Het
Cyp3a59 A G 5: 146,104,903 probably null Het
Ddx42 T A 11: 106,231,138 Y160N probably damaging Het
Dhx35 A T 2: 158,806,401 R60W probably damaging Het
Gbp10 T C 5: 105,224,651 probably null Het
Gtf2i T C 5: 134,255,037 T467A possibly damaging Het
Hip1r G C 5: 123,997,862 G542A possibly damaging Het
Hspg2 G A 4: 137,548,122 A2748T probably benign Het
Kcnq3 T C 15: 65,995,511 Y761C probably benign Het
Krt13 T G 11: 100,118,935 T340P possibly damaging Het
Map2k5 A G 9: 63,164,130 C435R probably damaging Het
Ms4a4c T A 19: 11,416,375 I53K probably damaging Het
Myh15 T A 16: 49,109,344 F544L probably damaging Het
Neurod2 G T 11: 98,328,200 S46* probably null Het
Nsd3 T A 8: 25,641,272 S218T probably damaging Het
Olfr1184 A T 2: 88,487,241 N170Y probably damaging Het
Olfr706 G T 7: 106,886,453 D121E probably damaging Het
Prrc2c TTGCTGCTGCTGCTGCTGCTGCTGCTGC TTGCTGCTGCTGCTGCTGCTGCTGC 1: 162,709,061 probably benign Het
Ranbp17 A T 11: 33,475,056 D433E probably benign Het
Rbm28 T C 6: 29,154,837 D278G probably damaging Het
Sbpl A G 17: 23,954,886 L8P unknown Het
Spopl C T 2: 23,517,945 V241M probably damaging Het
Tdrd3 A G 14: 87,486,283 E311G probably damaging Het
Tma16 C T 8: 66,484,171 probably null Het
Ubr4 A G 4: 139,461,856 N3917D possibly damaging Het
Vmn2r68 TCC TC 7: 85,221,550 probably null Het
Vmn2r72 T C 7: 85,738,500 N619D probably damaging Het
Xab2 C A 8: 3,614,244 probably null Het
Other mutations in Prrg3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01393:Prrg3 APN X 71967517 missense probably benign 0.02
IGL03201:Prrg3 APN X 71966502 missense probably damaging 0.96
R4399:Prrg3 UTSW X 71967309 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCAGTCTACTCAGTTCGAGACC -3'
(R):5'- GTGCAGTCACCTCCTCATAG -3'

Sequencing Primer
(F):5'- CAGAGCTCAGATGCTATGTATGTG -3'
(R):5'- TCCTCATAGGAAGGGGGAGG -3'
Posted On2015-07-07