Incidental Mutation 'R4422:Vsig10'
ID327138
Institutional Source Beutler Lab
Gene Symbol Vsig10
Ensembl Gene ENSMUSG00000066894
Gene NameV-set and immunoglobulin domain containing 10
Synonyms
MMRRC Submission 041695-MU
Accession Numbers

Genbank: NM_001033311; MGI: 2448533

Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R4422 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location117319083-117355005 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 117324921 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 71 (S71P)
Ref Sequence ENSEMBL: ENSMUSP00000107598 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086464] [ENSMUST00000111967]
Predicted Effect probably benign
Transcript: ENSMUST00000086464
AA Change: S44P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000083655
Gene: ENSMUSG00000066894
AA Change: S44P

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
IG 23 114 4.03e-8 SMART
IG 132 214 9.49e-5 SMART
Pfam:Ig_2 215 300 2.6e-2 PFAM
Pfam:Ig_3 216 284 3.5e-4 PFAM
IGc2 313 384 1.12e-6 SMART
transmembrane domain 403 425 N/A INTRINSIC
coiled coil region 446 481 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111967
AA Change: S71P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000107598
Gene: ENSMUSG00000066894
AA Change: S71P

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
IG 50 141 4.03e-8 SMART
IG 159 241 9.49e-5 SMART
Blast:IG_like 248 327 2e-33 BLAST
IGc2 340 411 1.12e-6 SMART
transmembrane domain 430 452 N/A INTRINSIC
coiled coil region 473 508 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128524
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145052
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147182
SMART Domains Protein: ENSMUSP00000125808
Gene: ENSMUSG00000066894

DomainStartEndE-ValueType
Blast:IG_like 1 41 3e-14 BLAST
IGc2 54 125 1.12e-6 SMART
transmembrane domain 144 166 N/A INTRINSIC
coiled coil region 187 222 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 96% (67/70)
Allele List at MGI

All alleles(11) : Gene trapped(11)

Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts13 T C 2: 27,005,400 S1168P probably benign Het
Adgrf2 T C 17: 42,713,155 M142V probably benign Het
Akna G T 4: 63,387,093 Q479K possibly damaging Het
Arhgef9 T G X: 95,101,064 I131L possibly damaging Het
AW551984 A T 9: 39,600,077 C111S probably null Het
Bak1 C A 17: 27,021,324 G130W probably damaging Het
Bank1 T A 3: 136,083,211 Q441L probably damaging Het
C030034I22Rik T C 17: 69,418,158 noncoding transcript Het
Capns2 T A 8: 92,901,624 I47N possibly damaging Het
Cct7 A G 6: 85,467,145 R355G probably damaging Het
Cd19 C T 7: 126,413,406 V272I probably benign Het
Cenpf A G 1: 189,658,350 L1095S probably damaging Het
Cep44 G A 8: 56,538,617 P317S probably benign Het
Chrm3 A T 13: 9,878,555 Y148* probably null Het
Chrnb3 T C 8: 27,396,733 V445A possibly damaging Het
Col4a4 T A 1: 82,489,838 M852L unknown Het
Dhx29 T C 13: 112,947,247 L612P probably damaging Het
Dlgap2 T C 8: 14,743,463 probably null Het
Dnah17 T C 11: 118,081,973 T2045A possibly damaging Het
Dync1li1 A G 9: 114,709,309 T245A probably damaging Het
Epha4 T C 1: 77,511,717 E42G probably damaging Het
Fam120b C A 17: 15,402,183 T141K probably damaging Het
Fhod1 T C 8: 105,337,351 probably benign Het
Gcnt2 T G 13: 40,860,525 Y57* probably null Het
Gm5409 C T 6: 41,419,585 noncoding transcript Het
Hip1r A G 5: 123,997,006 K402E possibly damaging Het
Hlcs G A 16: 94,138,960 P506L possibly damaging Het
Itih4 T A 14: 30,889,864 F142I probably damaging Het
Krt78 T C 15: 101,947,940 T479A probably benign Het
Lamb2 A G 9: 108,483,555 D518G probably damaging Het
Ldlr G A 9: 21,737,952 C341Y probably damaging Het
Lsr G T 7: 30,965,997 N177K probably benign Het
Macf1 G A 4: 123,466,046 S1815F probably damaging Het
Mms22l T C 4: 24,503,008 S95P probably damaging Het
Mon2 A G 10: 123,042,982 L218P probably damaging Het
Nlrp4f C T 13: 65,184,962 probably null Het
Nrde2 G A 12: 100,146,027 Q137* probably null Het
Olfr1145 C A 2: 87,810,645 T275K probably damaging Het
Olfr5 G T 7: 6,481,038 Y39* probably null Het
Olfr606 G T 7: 103,452,243 R302L probably damaging Het
Phf24 G A 4: 42,934,817 C151Y probably damaging Het
Pik3r1 T G 13: 101,694,384 N3T probably benign Het
Plcb2 T C 2: 118,712,003 K821E probably benign Het
Ppat A G 5: 76,915,214 W517R probably damaging Het
Prelid2 T C 18: 41,912,396 T150A probably benign Het
Psg21 A G 7: 18,647,332 S429P probably damaging Het
Reg4 T C 3: 98,233,044 Y114H possibly damaging Het
Rsbn1l G T 5: 20,896,546 H665Q probably damaging Het
Rspo2 T C 15: 43,169,754 N24S probably benign Het
Ryr2 G T 13: 11,717,066 C2329* probably null Het
Skint2 T A 4: 112,584,588 probably benign Het
Syvn1 C T 19: 6,049,921 probably benign Het
Thegl T C 5: 77,054,536 I268T possibly damaging Het
Tmem53 T C 4: 117,265,952 Y37H probably damaging Het
Tmem59l G A 8: 70,486,099 R111W probably damaging Het
Tnks2 G A 19: 36,845,653 V107I probably damaging Het
Tpcn1 T C 5: 120,542,518 K549R probably damaging Het
Tubgcp4 T A 2: 121,189,401 L404* probably null Het
Vmn2r86 T C 10: 130,452,976 I219V possibly damaging Het
Wnk1 T C 6: 119,953,895 N896S probably benign Het
Zfp871 C A 17: 32,774,833 S456I probably benign Het
Zfp871 T A 17: 32,774,834 S437C probably benign Het
Zfp873 A G 10: 82,060,874 T480A probably benign Het
Other mutations in Vsig10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Vsig10 APN 5 117338414 missense probably benign 0.00
IGL00340:Vsig10 APN 5 117351587 missense probably benign 0.03
IGL01082:Vsig10 APN 5 117334905 missense probably benign 0.33
IGL01285:Vsig10 APN 5 117324889 missense probably benign 0.43
IGL01790:Vsig10 APN 5 117338314 missense probably damaging 1.00
IGL03004:Vsig10 APN 5 117325075 missense probably damaging 1.00
D3080:Vsig10 UTSW 5 117343819 missense probably damaging 1.00
R0101:Vsig10 UTSW 5 117335069 critical splice donor site probably null
R0403:Vsig10 UTSW 5 117338461 missense probably benign 0.05
R0674:Vsig10 UTSW 5 117343846 missense probably damaging 1.00
R1437:Vsig10 UTSW 5 117351570 missense probably damaging 0.96
R1689:Vsig10 UTSW 5 117352760 missense probably benign 0.00
R1710:Vsig10 UTSW 5 117351654 missense probably benign
R1765:Vsig10 UTSW 5 117318815 unclassified probably benign
R4541:Vsig10 UTSW 5 117352816 utr 3 prime probably benign
R4909:Vsig10 UTSW 5 117338243 missense probably benign 0.31
R4999:Vsig10 UTSW 5 117343975 missense probably damaging 1.00
R5855:Vsig10 UTSW 5 117338270 missense probably damaging 1.00
R5866:Vsig10 UTSW 5 117352749 critical splice acceptor site probably null
R6214:Vsig10 UTSW 5 117343924 missense probably damaging 1.00
R6418:Vsig10 UTSW 5 117348296 missense probably benign 0.03
R6505:Vsig10 UTSW 5 117351759 missense possibly damaging 0.95
R6854:Vsig10 UTSW 5 117338407 missense probably benign 0.36
R7121:Vsig10 UTSW 5 117343902 missense probably damaging 1.00
R7596:Vsig10 UTSW 5 117334783 missense possibly damaging 0.46
R8066:Vsig10 UTSW 5 117351784 missense probably benign 0.00
R8335:Vsig10 UTSW 5 117348370 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACGCACGCACATGACATTG -3'
(R):5'- AGTCTCACTTACTGGCCACC -3'

Sequencing Primer
(F):5'- GCACGCACATGACATTGCTATTAG -3'
(R):5'- CCAGTGGGTCTCATTCAGAAC -3'
Posted On2015-07-07