Incidental Mutation 'R0016:Trim27'
ID32714
Institutional Source Beutler Lab
Gene Symbol Trim27
Ensembl Gene ENSMUSG00000021326
Gene Nametripartite motif-containing 27
SynonymsRfp
MMRRC Submission 038311-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.339) question?
Stock #R0016 (G1)
Quality Score225
Status Validated (trace)
Chromosome13
Chromosomal Location21179445-21194724 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 21191229 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 310 (E310V)
Ref Sequence ENSEMBL: ENSMUSP00000152730 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021761] [ENSMUST00000221464] [ENSMUST00000222544] [ENSMUST00000223065]
Predicted Effect probably benign
Transcript: ENSMUST00000021761
AA Change: E310V

PolyPhen 2 Score 0.145 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000021761
Gene: ENSMUSG00000021326
AA Change: E310V

DomainStartEndE-ValueType
RING 16 56 2.53e-6 SMART
BBOX 91 132 4.71e-15 SMART
low complexity region 146 170 N/A INTRINSIC
low complexity region 199 210 N/A INTRINSIC
PRY 315 367 7.09e-28 SMART
SPRY 368 493 1e-42 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124794
Predicted Effect probably benign
Transcript: ENSMUST00000139287
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220690
Predicted Effect probably benign
Transcript: ENSMUST00000221464
AA Change: E134V

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
Predicted Effect probably benign
Transcript: ENSMUST00000222544
AA Change: E310V

PolyPhen 2 Score 0.145 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect probably benign
Transcript: ENSMUST00000223065
AA Change: R308S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Meta Mutation Damage Score 0.1448 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 93.2%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. This protein localizes to the nuclear matrix. It interacts with the enhancer of polycomb protein and represses gene transcription. It is also thought to be involved in the differentiation of male germ cells. Fusion of the N-terminus of this protein with the truncated C-terminus of the RET gene product has been shown to result in production of the ret transforming protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit exhibit increased potassium/calcium channel activity and TCR-stimulated calcium influx in Th1 and Th2 CD4 T cells. Mice homozygous for another gene trap allele exhibit decreased incidence of chemically-induced tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 A C 1: 71,294,800 V1181G probably benign Het
Adamts12 A T 15: 11,217,829 I291F probably damaging Het
Aspm G C 1: 139,479,544 Q2056H probably benign Het
BC067074 T C 13: 113,366,105 Y115H probably damaging Het
C7 A T 15: 5,046,924 V122E probably benign Het
Casp12 A T 9: 5,352,844 Q152L probably null Het
Cdh16 T A 8: 104,617,632 T92S probably benign Het
Chrd G C 16: 20,734,308 V162L possibly damaging Het
Cpne8 A G 15: 90,501,405 probably benign Het
Cyp2j7 T A 4: 96,202,147 I347F probably damaging Het
Cyp4a10 A T 4: 115,521,107 Q130L probably damaging Het
Dach1 C T 14: 98,168,748 G188R probably damaging Het
Dgkd T C 1: 87,917,952 S294P probably benign Het
Dnah8 A G 17: 30,663,316 I621V probably benign Het
Dync2h1 A G 9: 7,144,346 probably benign Het
Echdc1 A T 10: 29,322,421 probably benign Het
Elovl3 T A 19: 46,132,158 F30Y probably damaging Het
Fa2h T C 8: 111,393,514 Y80C probably damaging Het
Fam208b A C 13: 3,585,170 probably null Het
Fgd3 C T 13: 49,296,609 D55N probably benign Het
Fhod1 T C 8: 105,331,655 E823G possibly damaging Het
Gapvd1 A G 2: 34,699,913 probably benign Het
Gm17067 A T 7: 42,708,622 I152K probably benign Het
Gm1966 G A 7: 106,603,246 L264F probably benign Het
Gm9833 A T 3: 10,089,319 M383L possibly damaging Het
Kif27 A G 13: 58,354,714 V50A probably damaging Het
Kpna2 T C 11: 106,991,086 T305A probably benign Het
Krtap22-2 A G 16: 89,010,519 probably benign Het
Lrp2bp T A 8: 46,012,031 F62L probably damaging Het
Marf1 G A 16: 14,152,265 H197Y probably damaging Het
Mob3b A G 4: 35,083,947 F81L probably benign Het
Mon2 C T 10: 123,035,546 V389M probably damaging Het
Myh8 A G 11: 67,298,525 K1176E probably damaging Het
Naf1 T C 8: 66,889,055 probably benign Het
Nckap1l A G 15: 103,475,636 T554A probably benign Het
Oog3 A G 4: 144,158,071 Y432H probably damaging Het
Paxbp1 A T 16: 91,036,036 probably benign Het
Phf20 A T 2: 156,267,194 K154* probably null Het
Plekhj1 T C 10: 80,796,416 D74G possibly damaging Het
Plpp4 T C 7: 129,323,424 C128R probably damaging Het
Rcan3 A T 4: 135,418,378 probably null Het
Sh3rf1 T A 8: 61,374,138 M642K probably benign Het
Slc7a1 A G 5: 148,334,583 V522A probably benign Het
Sorbs1 A G 19: 40,314,738 probably benign Het
Spry2 C T 14: 105,893,297 V152M probably benign Het
Srgap2 A G 1: 131,349,462 M349T possibly damaging Het
Stag3 A G 5: 138,291,381 H271R possibly damaging Het
Stat4 T C 1: 52,068,780 V136A probably benign Het
Stc2 A T 11: 31,360,177 D286E probably benign Het
Stk31 T C 6: 49,437,377 Y482H probably damaging Het
Ticrr C T 7: 79,693,792 P1135L probably benign Het
Tmem55b C T 14: 50,928,894 R213Q probably damaging Het
Uvrag T C 7: 98,991,981 K284R probably benign Het
Vmn1r78 A C 7: 12,153,352 S297R probably benign Het
Xylt2 A G 11: 94,669,640 S270P probably damaging Het
Zfhx3 T C 8: 108,950,178 M2620T probably benign Het
Zkscan2 C A 7: 123,499,996 probably benign Het
Zwint T C 10: 72,657,198 probably benign Het
Other mutations in Trim27
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01865:Trim27 APN 13 21192492 missense probably damaging 0.98
IGL02756:Trim27 APN 13 21190086 splice site probably benign
IGL03199:Trim27 APN 13 21191251 splice site probably null
R0016:Trim27 UTSW 13 21191229 missense probably benign 0.14
R1709:Trim27 UTSW 13 21188065 critical splice donor site probably null
R2188:Trim27 UTSW 13 21183817 missense probably damaging 1.00
R4472:Trim27 UTSW 13 21189886 missense probably benign 0.00
R4657:Trim27 UTSW 13 21183760 missense probably damaging 1.00
R4677:Trim27 UTSW 13 21180916 critical splice donor site probably null
R5019:Trim27 UTSW 13 21189964 missense probably damaging 1.00
R5584:Trim27 UTSW 13 21192549 missense probably damaging 1.00
R6226:Trim27 UTSW 13 21180916 critical splice donor site probably benign
R6774:Trim27 UTSW 13 21192454 missense probably damaging 1.00
R7378:Trim27 UTSW 13 21192461 missense possibly damaging 0.92
R7573:Trim27 UTSW 13 21180600 missense probably damaging 0.96
R7662:Trim27 UTSW 13 21192158 missense probably benign 0.05
X0062:Trim27 UTSW 13 21183874 missense probably benign 0.44
Predicted Primers PCR Primer
(F):5'- AGTACCCAATTGACACAGGCGTTC -3'
(R):5'- CACATCTAAGGCTCAACCTCCTTCG -3'

Sequencing Primer
(F):5'- ACACAGGCGTTCTGCAATG -3'
(R):5'- atgtccctgcctcatgttc -3'
Posted On2013-05-09