Incidental Mutation 'R4422:Olfr5'
ID327145
Institutional Source Beutler Lab
Gene Symbol Olfr5
Ensembl Gene ENSMUSG00000096228
Gene Nameolfactory receptor 5
SynonymsMOR103-8, GA_x6K02T2QGBW-3210997-3210059
MMRRC Submission 041695-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.139) question?
Stock #R4422 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location6478322-6486941 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 6481038 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 39 (Y39*)
Ref Sequence ENSEMBL: ENSMUSP00000147586 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086318] [ENSMUST00000207658] [ENSMUST00000209866] [ENSMUST00000215302]
Predicted Effect probably null
Transcript: ENSMUST00000086318
AA Change: Y39*
SMART Domains Protein: ENSMUSP00000083498
Gene: ENSMUSG00000096228
AA Change: Y39*

DomainStartEndE-ValueType
Pfam:7tm_4 35 311 2.1e-50 PFAM
Pfam:7tm_1 45 294 6.9e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000207658
Predicted Effect probably null
Transcript: ENSMUST00000209866
AA Change: Y39*
Predicted Effect probably benign
Transcript: ENSMUST00000215302
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 96% (67/70)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts13 T C 2: 27,005,400 S1168P probably benign Het
Adgrf2 T C 17: 42,713,155 M142V probably benign Het
Akna G T 4: 63,387,093 Q479K possibly damaging Het
Arhgef9 T G X: 95,101,064 I131L possibly damaging Het
AW551984 A T 9: 39,600,077 C111S probably null Het
Bak1 C A 17: 27,021,324 G130W probably damaging Het
Bank1 T A 3: 136,083,211 Q441L probably damaging Het
C030034I22Rik T C 17: 69,418,158 noncoding transcript Het
Capns2 T A 8: 92,901,624 I47N possibly damaging Het
Cct7 A G 6: 85,467,145 R355G probably damaging Het
Cd19 C T 7: 126,413,406 V272I probably benign Het
Cenpf A G 1: 189,658,350 L1095S probably damaging Het
Cep44 G A 8: 56,538,617 P317S probably benign Het
Chrm3 A T 13: 9,878,555 Y148* probably null Het
Chrnb3 T C 8: 27,396,733 V445A possibly damaging Het
Col4a4 T A 1: 82,489,838 M852L unknown Het
Dhx29 T C 13: 112,947,247 L612P probably damaging Het
Dlgap2 T C 8: 14,743,463 probably null Het
Dnah17 T C 11: 118,081,973 T2045A possibly damaging Het
Dync1li1 A G 9: 114,709,309 T245A probably damaging Het
Epha4 T C 1: 77,511,717 E42G probably damaging Het
Fam120b C A 17: 15,402,183 T141K probably damaging Het
Fhod1 T C 8: 105,337,351 probably benign Het
Gcnt2 T G 13: 40,860,525 Y57* probably null Het
Gm5409 C T 6: 41,419,585 noncoding transcript Het
Hip1r A G 5: 123,997,006 K402E possibly damaging Het
Hlcs G A 16: 94,138,960 P506L possibly damaging Het
Itih4 T A 14: 30,889,864 F142I probably damaging Het
Krt78 T C 15: 101,947,940 T479A probably benign Het
Lamb2 A G 9: 108,483,555 D518G probably damaging Het
Ldlr G A 9: 21,737,952 C341Y probably damaging Het
Lsr G T 7: 30,965,997 N177K probably benign Het
Macf1 G A 4: 123,466,046 S1815F probably damaging Het
Mms22l T C 4: 24,503,008 S95P probably damaging Het
Mon2 A G 10: 123,042,982 L218P probably damaging Het
Nlrp4f C T 13: 65,184,962 probably null Het
Nrde2 G A 12: 100,146,027 Q137* probably null Het
Olfr1145 C A 2: 87,810,645 T275K probably damaging Het
Olfr606 G T 7: 103,452,243 R302L probably damaging Het
Phf24 G A 4: 42,934,817 C151Y probably damaging Het
Pik3r1 T G 13: 101,694,384 N3T probably benign Het
Plcb2 T C 2: 118,712,003 K821E probably benign Het
Ppat A G 5: 76,915,214 W517R probably damaging Het
Prelid2 T C 18: 41,912,396 T150A probably benign Het
Psg21 A G 7: 18,647,332 S429P probably damaging Het
Reg4 T C 3: 98,233,044 Y114H possibly damaging Het
Rsbn1l G T 5: 20,896,546 H665Q probably damaging Het
Rspo2 T C 15: 43,169,754 N24S probably benign Het
Ryr2 G T 13: 11,717,066 C2329* probably null Het
Skint2 T A 4: 112,584,588 probably benign Het
Syvn1 C T 19: 6,049,921 probably benign Het
Thegl T C 5: 77,054,536 I268T possibly damaging Het
Tmem53 T C 4: 117,265,952 Y37H probably damaging Het
Tmem59l G A 8: 70,486,099 R111W probably damaging Het
Tnks2 G A 19: 36,845,653 V107I probably damaging Het
Tpcn1 T C 5: 120,542,518 K549R probably damaging Het
Tubgcp4 T A 2: 121,189,401 L404* probably null Het
Vmn2r86 T C 10: 130,452,976 I219V possibly damaging Het
Vsig10 T C 5: 117,324,921 S71P probably benign Het
Wnk1 T C 6: 119,953,895 N896S probably benign Het
Zfp871 C A 17: 32,774,833 S456I probably benign Het
Zfp871 T A 17: 32,774,834 S437C probably benign Het
Zfp873 A G 10: 82,060,874 T480A probably benign Het
Other mutations in Olfr5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01336:Olfr5 APN 7 6480998 missense probably benign
IGL02174:Olfr5 APN 7 6480439 missense probably benign
IGL03260:Olfr5 APN 7 6480659 missense probably damaging 0.99
IGL03411:Olfr5 APN 7 6480436 missense probably benign 0.26
R1186:Olfr5 UTSW 7 6480542 missense probably benign 0.00
R1381:Olfr5 UTSW 7 6481009 unclassified probably null
R1981:Olfr5 UTSW 7 6480932 missense probably benign 0.29
R1982:Olfr5 UTSW 7 6480932 missense probably benign 0.29
R3876:Olfr5 UTSW 7 6481132 missense probably benign 0.01
R3907:Olfr5 UTSW 7 6480679 missense probably damaging 1.00
R4654:Olfr5 UTSW 7 6481046 missense probably benign 0.00
R5605:Olfr5 UTSW 7 6480326 missense probably benign 0.00
R6962:Olfr5 UTSW 7 6481009 missense probably benign 0.07
R7524:Olfr5 UTSW 7 6480587 missense probably benign 0.04
R7576:Olfr5 UTSW 7 6480331 missense probably damaging 0.97
Z1177:Olfr5 UTSW 7 6480873 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGGAATATGGTAGAGTCCATTCC -3'
(R):5'- TCCCTGGAGATGACCACTAG -3'

Sequencing Primer
(F):5'- TTCCATAGCCCCATGAGTAAGGTG -3'
(R):5'- GGTGTAAAGTACTGTGAACATCCCTC -3'
Posted On2015-07-07