Incidental Mutation 'R4422:Mon2'
ID327161
Institutional Source Beutler Lab
Gene Symbol Mon2
Ensembl Gene ENSMUSG00000034602
Gene NameMON2 homolog, regulator of endosome to Golgi trafficking
Synonyms2610528O22Rik, SF21
MMRRC Submission 041695-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.842) question?
Stock #R4422 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location122992060-123076505 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 123042982 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 218 (L218P)
Ref Sequence ENSEMBL: ENSMUSP00000151951 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037557] [ENSMUST00000073792] [ENSMUST00000170935] [ENSMUST00000219203]
Predicted Effect probably damaging
Transcript: ENSMUST00000037557
AA Change: L218P

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000037568
Gene: ENSMUSG00000034602
AA Change: L218P

DomainStartEndE-ValueType
low complexity region 119 138 N/A INTRINSIC
low complexity region 164 176 N/A INTRINSIC
Pfam:Sec7_N 208 294 6.5e-16 PFAM
Pfam:Sec7_N 299 385 2.6e-16 PFAM
low complexity region 405 438 N/A INTRINSIC
low complexity region 558 575 N/A INTRINSIC
low complexity region 615 627 N/A INTRINSIC
Pfam:DUF1981 844 929 2.4e-21 PFAM
low complexity region 984 1001 N/A INTRINSIC
low complexity region 1182 1193 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000073792
AA Change: L218P

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000073462
Gene: ENSMUSG00000034602
AA Change: L218P

DomainStartEndE-ValueType
Pfam:DCB 8 184 3e-72 PFAM
Pfam:Sec7_N 211 384 3.1e-58 PFAM
low complexity region 405 438 N/A INTRINSIC
low complexity region 558 575 N/A INTRINSIC
low complexity region 615 627 N/A INTRINSIC
Pfam:DUF1981 848 929 6.6e-20 PFAM
Pfam:Mon2_C 932 1706 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000170935
AA Change: L218P

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000131052
Gene: ENSMUSG00000034602
AA Change: L218P

DomainStartEndE-ValueType
low complexity region 119 138 N/A INTRINSIC
low complexity region 164 176 N/A INTRINSIC
Pfam:Sec7_N 208 294 6.5e-16 PFAM
Pfam:Sec7_N 299 385 2.6e-16 PFAM
low complexity region 405 438 N/A INTRINSIC
low complexity region 559 576 N/A INTRINSIC
low complexity region 616 628 N/A INTRINSIC
Pfam:DUF1981 845 930 8.1e-22 PFAM
low complexity region 985 1002 N/A INTRINSIC
low complexity region 1183 1194 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000219203
AA Change: L218P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Meta Mutation Damage Score 0.8493 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 96% (67/70)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts13 T C 2: 27,005,400 S1168P probably benign Het
Adgrf2 T C 17: 42,713,155 M142V probably benign Het
Akna G T 4: 63,387,093 Q479K possibly damaging Het
Arhgef9 T G X: 95,101,064 I131L possibly damaging Het
AW551984 A T 9: 39,600,077 C111S probably null Het
Bak1 C A 17: 27,021,324 G130W probably damaging Het
Bank1 T A 3: 136,083,211 Q441L probably damaging Het
C030034I22Rik T C 17: 69,418,158 noncoding transcript Het
Capns2 T A 8: 92,901,624 I47N possibly damaging Het
Cct7 A G 6: 85,467,145 R355G probably damaging Het
Cd19 C T 7: 126,413,406 V272I probably benign Het
Cenpf A G 1: 189,658,350 L1095S probably damaging Het
Cep44 G A 8: 56,538,617 P317S probably benign Het
Chrm3 A T 13: 9,878,555 Y148* probably null Het
Chrnb3 T C 8: 27,396,733 V445A possibly damaging Het
Col4a4 T A 1: 82,489,838 M852L unknown Het
Dhx29 T C 13: 112,947,247 L612P probably damaging Het
Dlgap2 T C 8: 14,743,463 probably null Het
Dnah17 T C 11: 118,081,973 T2045A possibly damaging Het
Dync1li1 A G 9: 114,709,309 T245A probably damaging Het
Epha4 T C 1: 77,511,717 E42G probably damaging Het
Fam120b C A 17: 15,402,183 T141K probably damaging Het
Fhod1 T C 8: 105,337,351 probably benign Het
Gcnt2 T G 13: 40,860,525 Y57* probably null Het
Gm5409 C T 6: 41,419,585 noncoding transcript Het
Hip1r A G 5: 123,997,006 K402E possibly damaging Het
Hlcs G A 16: 94,138,960 P506L possibly damaging Het
Itih4 T A 14: 30,889,864 F142I probably damaging Het
Krt78 T C 15: 101,947,940 T479A probably benign Het
Lamb2 A G 9: 108,483,555 D518G probably damaging Het
Ldlr G A 9: 21,737,952 C341Y probably damaging Het
Lsr G T 7: 30,965,997 N177K probably benign Het
Macf1 G A 4: 123,466,046 S1815F probably damaging Het
Mms22l T C 4: 24,503,008 S95P probably damaging Het
Nlrp4f C T 13: 65,184,962 probably null Het
Nrde2 G A 12: 100,146,027 Q137* probably null Het
Olfr1145 C A 2: 87,810,645 T275K probably damaging Het
Olfr5 G T 7: 6,481,038 Y39* probably null Het
Olfr606 G T 7: 103,452,243 R302L probably damaging Het
Phf24 G A 4: 42,934,817 C151Y probably damaging Het
Pik3r1 T G 13: 101,694,384 N3T probably benign Het
Plcb2 T C 2: 118,712,003 K821E probably benign Het
Ppat A G 5: 76,915,214 W517R probably damaging Het
Prelid2 T C 18: 41,912,396 T150A probably benign Het
Psg21 A G 7: 18,647,332 S429P probably damaging Het
Reg4 T C 3: 98,233,044 Y114H possibly damaging Het
Rsbn1l G T 5: 20,896,546 H665Q probably damaging Het
Rspo2 T C 15: 43,169,754 N24S probably benign Het
Ryr2 G T 13: 11,717,066 C2329* probably null Het
Skint2 T A 4: 112,584,588 probably benign Het
Syvn1 C T 19: 6,049,921 probably benign Het
Thegl T C 5: 77,054,536 I268T possibly damaging Het
Tmem53 T C 4: 117,265,952 Y37H probably damaging Het
Tmem59l G A 8: 70,486,099 R111W probably damaging Het
Tnks2 G A 19: 36,845,653 V107I probably damaging Het
Tpcn1 T C 5: 120,542,518 K549R probably damaging Het
Tubgcp4 T A 2: 121,189,401 L404* probably null Het
Vmn2r86 T C 10: 130,452,976 I219V possibly damaging Het
Vsig10 T C 5: 117,324,921 S71P probably benign Het
Wnk1 T C 6: 119,953,895 N896S probably benign Het
Zfp871 C A 17: 32,774,833 S456I probably benign Het
Zfp871 T A 17: 32,774,834 S437C probably benign Het
Zfp873 A G 10: 82,060,874 T480A probably benign Het
Other mutations in Mon2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00497:Mon2 APN 10 123026299 missense probably damaging 1.00
IGL01072:Mon2 APN 10 123010539 nonsense probably null
IGL02080:Mon2 APN 10 123052190 missense probably damaging 0.98
IGL02157:Mon2 APN 10 123013472 missense probably damaging 1.00
IGL02419:Mon2 APN 10 123016447 missense probably benign 0.05
IGL02498:Mon2 APN 10 123034330 missense probably benign 0.00
IGL02638:Mon2 APN 10 123023939 missense probably damaging 1.00
IGL02664:Mon2 APN 10 123009496 splice site probably benign
IGL02690:Mon2 APN 10 123009627 missense possibly damaging 0.67
IGL02878:Mon2 APN 10 123006991 missense probably benign 0.09
IGL03092:Mon2 APN 10 123018100 missense probably damaging 1.00
IGL03103:Mon2 APN 10 123030103 splice site probably benign
IGL03208:Mon2 APN 10 123018069 splice site probably benign
R0010:Mon2 UTSW 10 123032694 missense probably damaging 1.00
R0016:Mon2 UTSW 10 123035546 missense probably damaging 0.96
R0016:Mon2 UTSW 10 123035546 missense probably damaging 0.96
R0027:Mon2 UTSW 10 123036048 missense possibly damaging 0.66
R0027:Mon2 UTSW 10 123036048 missense possibly damaging 0.66
R0145:Mon2 UTSW 10 123013512 missense possibly damaging 0.94
R0390:Mon2 UTSW 10 123007021 missense probably null 0.05
R0481:Mon2 UTSW 10 123013396 missense possibly damaging 0.94
R0513:Mon2 UTSW 10 123038610 missense probably damaging 1.00
R0599:Mon2 UTSW 10 123026065 splice site probably benign
R1226:Mon2 UTSW 10 123002819 missense probably benign 0.17
R1548:Mon2 UTSW 10 123036007 splice site probably benign
R1598:Mon2 UTSW 10 123016396 missense probably damaging 1.00
R1650:Mon2 UTSW 10 122995777 missense probably benign 0.45
R1687:Mon2 UTSW 10 123026124 missense probably damaging 0.98
R1721:Mon2 UTSW 10 123031097 missense probably damaging 0.98
R1768:Mon2 UTSW 10 123013763 missense probably benign 0.00
R1827:Mon2 UTSW 10 123046311 missense probably damaging 0.97
R1879:Mon2 UTSW 10 123002885 missense probably damaging 1.00
R1954:Mon2 UTSW 10 123038483 missense probably damaging 1.00
R1955:Mon2 UTSW 10 123038483 missense probably damaging 1.00
R1968:Mon2 UTSW 10 123009565 missense probably damaging 1.00
R2060:Mon2 UTSW 10 122995776 missense probably damaging 1.00
R2160:Mon2 UTSW 10 123075929 nonsense probably null
R2165:Mon2 UTSW 10 123042364 splice site probably null
R3737:Mon2 UTSW 10 123013375 missense probably damaging 1.00
R3814:Mon2 UTSW 10 123013565 missense probably damaging 0.98
R4058:Mon2 UTSW 10 123002819 missense probably benign 0.17
R4091:Mon2 UTSW 10 123038510 missense probably damaging 1.00
R4214:Mon2 UTSW 10 123016492 missense probably benign 0.03
R4354:Mon2 UTSW 10 123026983 missense probably benign 0.02
R4505:Mon2 UTSW 10 123009589 missense probably damaging 0.99
R4791:Mon2 UTSW 10 123006057 missense probably benign 0.01
R4797:Mon2 UTSW 10 123016517 missense probably benign 0.45
R4944:Mon2 UTSW 10 123038459 critical splice donor site probably null
R4982:Mon2 UTSW 10 122995789 missense probably damaging 1.00
R5298:Mon2 UTSW 10 123010606 missense probably benign
R5503:Mon2 UTSW 10 123032645 missense possibly damaging 0.54
R5653:Mon2 UTSW 10 123026094 missense probably damaging 0.96
R5687:Mon2 UTSW 10 123008239 missense probably damaging 0.99
R5838:Mon2 UTSW 10 123010492 critical splice donor site probably null
R6108:Mon2 UTSW 10 123032695 missense probably benign 0.00
R6182:Mon2 UTSW 10 123038659 splice site probably null
R6355:Mon2 UTSW 10 123022920 missense possibly damaging 0.58
R6358:Mon2 UTSW 10 123013504 missense probably damaging 0.98
R6548:Mon2 UTSW 10 123036093 missense probably damaging 1.00
R6557:Mon2 UTSW 10 123016402 missense probably damaging 1.00
R6649:Mon2 UTSW 10 123038480 missense possibly damaging 0.46
R7140:Mon2 UTSW 10 123035453 missense probably benign 0.00
R7303:Mon2 UTSW 10 123038459 critical splice donor site probably null
R7317:Mon2 UTSW 10 123013946 missense probably damaging 0.97
R7355:Mon2 UTSW 10 123009516 missense probably benign
R7508:Mon2 UTSW 10 123023939 missense probably damaging 1.00
R7509:Mon2 UTSW 10 123032552 missense probably benign
R7647:Mon2 UTSW 10 123006026 missense probably benign
R7720:Mon2 UTSW 10 123032588 missense probably benign 0.00
R7799:Mon2 UTSW 10 123042331 missense probably benign 0.41
R7801:Mon2 UTSW 10 123059186 critical splice donor site probably null
R7823:Mon2 UTSW 10 123032654 missense probably damaging 1.00
R7985:Mon2 UTSW 10 123016308 missense probably damaging 1.00
R8310:Mon2 UTSW 10 123002783 missense probably damaging 1.00
X0022:Mon2 UTSW 10 123006102 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- GTGGCCCAACATTTTATCATGC -3'
(R):5'- GTCAGAGATCATGTGATAAAAGCTG -3'

Sequencing Primer
(F):5'- GCTAGTTAGGTATACAGTAGATGCG -3'
(R):5'- GAAGACATGGTTCTTTAAACAGGAAC -3'
Posted On2015-07-07