Incidental Mutation 'R4422:Dhx29'
ID 327169
Institutional Source Beutler Lab
Gene Symbol Dhx29
Ensembl Gene ENSMUSG00000042426
Gene Name DEAH (Asp-Glu-Ala-His) box polypeptide 29
Synonyms E130202M19Rik
MMRRC Submission 041695-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R4422 (G1)
Quality Score 225
Status Validated
Chromosome 13
Chromosomal Location 112927454-112969432 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 112947247 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 612 (L612P)
Ref Sequence ENSEMBL: ENSMUSP00000035244 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038574]
AlphaFold Q6PGC1
Predicted Effect probably damaging
Transcript: ENSMUST00000038574
AA Change: L612P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000035244
Gene: ENSMUSG00000042426
AA Change: L612P

DomainStartEndE-ValueType
low complexity region 10 36 N/A INTRINSIC
low complexity region 41 54 N/A INTRINSIC
low complexity region 209 225 N/A INTRINSIC
low complexity region 240 255 N/A INTRINSIC
coiled coil region 279 308 N/A INTRINSIC
low complexity region 343 358 N/A INTRINSIC
Blast:DEXDc 411 450 2e-14 BLAST
DEXDc 569 763 1.09e-27 SMART
low complexity region 846 856 N/A INTRINSIC
HELICc 880 985 6.1e-17 SMART
HA2 1047 1138 8.9e-26 SMART
Pfam:OB_NTP_bind 1178 1298 3.8e-19 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 96% (67/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DEAH (Asp-Glu-Ala-His) subfamily of proteins, part of the DEAD (Asp-Glu-Ala-Asp) box family of RNA helicases. The encoded protein functions in translation initiation, and is specifically required for ribosomal scanning across stable mRNA secondary structures during initiation codon selection. This protein may also play a role in sensing virally derived cytosolic nucleic acids. Knockdown of this gene results in reduced protein translation and impaired proliferation of cancer cells. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit embryonic lethality at E7. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts13 T C 2: 27,005,400 S1168P probably benign Het
Adgrf2 T C 17: 42,713,155 M142V probably benign Het
Akna G T 4: 63,387,093 Q479K possibly damaging Het
Arhgef9 T G X: 95,101,064 I131L possibly damaging Het
AW551984 A T 9: 39,600,077 C111S probably null Het
Bak1 C A 17: 27,021,324 G130W probably damaging Het
Bank1 T A 3: 136,083,211 Q441L probably damaging Het
C030034I22Rik T C 17: 69,418,158 noncoding transcript Het
Capns2 T A 8: 92,901,624 I47N possibly damaging Het
Cct7 A G 6: 85,467,145 R355G probably damaging Het
Cd19 C T 7: 126,413,406 V272I probably benign Het
Cenpf A G 1: 189,658,350 L1095S probably damaging Het
Cep44 G A 8: 56,538,617 P317S probably benign Het
Chrm3 A T 13: 9,878,555 Y148* probably null Het
Chrnb3 T C 8: 27,396,733 V445A possibly damaging Het
Col4a4 T A 1: 82,489,838 M852L unknown Het
Dlgap2 T C 8: 14,743,463 probably null Het
Dnah17 T C 11: 118,081,973 T2045A possibly damaging Het
Dync1li1 A G 9: 114,709,309 T245A probably damaging Het
Epha4 T C 1: 77,511,717 E42G probably damaging Het
Fam120b C A 17: 15,402,183 T141K probably damaging Het
Fhod1 T C 8: 105,337,351 probably benign Het
Gcnt2 T G 13: 40,860,525 Y57* probably null Het
Gm5409 C T 6: 41,419,585 noncoding transcript Het
Hip1r A G 5: 123,997,006 K402E possibly damaging Het
Hlcs G A 16: 94,138,960 P506L possibly damaging Het
Itih4 T A 14: 30,889,864 F142I probably damaging Het
Krt78 T C 15: 101,947,940 T479A probably benign Het
Lamb2 A G 9: 108,483,555 D518G probably damaging Het
Ldlr G A 9: 21,737,952 C341Y probably damaging Het
Lsr G T 7: 30,965,997 N177K probably benign Het
Macf1 G A 4: 123,466,046 S1815F probably damaging Het
Mms22l T C 4: 24,503,008 S95P probably damaging Het
Mon2 A G 10: 123,042,982 L218P probably damaging Het
Nlrp4f C T 13: 65,184,962 probably null Het
Nrde2 G A 12: 100,146,027 Q137* probably null Het
Olfr1145 C A 2: 87,810,645 T275K probably damaging Het
Olfr5 G T 7: 6,481,038 Y39* probably null Het
Olfr606 G T 7: 103,452,243 R302L probably damaging Het
Phf24 G A 4: 42,934,817 C151Y probably damaging Het
Pik3r1 T G 13: 101,694,384 N3T probably benign Het
Plcb2 T C 2: 118,712,003 K821E probably benign Het
Ppat A G 5: 76,915,214 W517R probably damaging Het
Prelid2 T C 18: 41,912,396 T150A probably benign Het
Psg21 A G 7: 18,647,332 S429P probably damaging Het
Reg4 T C 3: 98,233,044 Y114H possibly damaging Het
Rsbn1l G T 5: 20,896,546 H665Q probably damaging Het
Rspo2 T C 15: 43,169,754 N24S probably benign Het
Ryr2 G T 13: 11,717,066 C2329* probably null Het
Skint2 T A 4: 112,584,588 probably benign Het
Syvn1 C T 19: 6,049,921 probably benign Het
Thegl T C 5: 77,054,536 I268T possibly damaging Het
Tmem53 T C 4: 117,265,952 Y37H probably damaging Het
Tmem59l G A 8: 70,486,099 R111W probably damaging Het
Tnks2 G A 19: 36,845,653 V107I probably damaging Het
Tpcn1 T C 5: 120,542,518 K549R probably damaging Het
Tubgcp4 T A 2: 121,189,401 L404* probably null Het
Vmn2r86 T C 10: 130,452,976 I219V possibly damaging Het
Vsig10 T C 5: 117,324,921 S71P probably benign Het
Wnk1 T C 6: 119,953,895 N896S probably benign Het
Zfp871 C A 17: 32,774,833 S456I probably benign Het
Zfp871 T A 17: 32,774,834 S437C probably benign Het
Zfp873 A G 10: 82,060,874 T480A probably benign Het
Other mutations in Dhx29
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Dhx29 APN 13 112964603 missense probably benign 0.15
IGL00434:Dhx29 APN 13 112955225 missense probably benign 0.00
IGL00659:Dhx29 APN 13 112966635 splice site probably benign
IGL01618:Dhx29 APN 13 112965222 missense probably damaging 1.00
IGL01777:Dhx29 APN 13 112930872 missense probably benign 0.42
IGL02010:Dhx29 APN 13 112966634 critical splice donor site probably null
IGL02125:Dhx29 APN 13 112955300 splice site probably benign
IGL02324:Dhx29 APN 13 112927808 missense probably damaging 1.00
IGL02801:Dhx29 APN 13 112964646 missense probably damaging 1.00
R0001:Dhx29 UTSW 13 112964556 missense probably damaging 0.99
R0362:Dhx29 UTSW 13 112962859 missense probably benign
R0468:Dhx29 UTSW 13 112963277 missense probably benign
R0569:Dhx29 UTSW 13 112948214 missense probably benign 0.01
R0714:Dhx29 UTSW 13 112927965 missense possibly damaging 0.55
R1460:Dhx29 UTSW 13 112965210 splice site probably benign
R1579:Dhx29 UTSW 13 112935598 critical splice donor site probably null
R1657:Dhx29 UTSW 13 112952843 missense probably damaging 1.00
R1735:Dhx29 UTSW 13 112945086 missense probably benign 0.00
R1768:Dhx29 UTSW 13 112948240 missense probably damaging 1.00
R1851:Dhx29 UTSW 13 112948281 missense probably damaging 1.00
R1937:Dhx29 UTSW 13 112965330 missense probably benign 0.06
R2180:Dhx29 UTSW 13 112962872 critical splice donor site probably null
R2219:Dhx29 UTSW 13 112952804 missense probably damaging 1.00
R2442:Dhx29 UTSW 13 112946974 missense possibly damaging 0.94
R2679:Dhx29 UTSW 13 112947376 critical splice donor site probably null
R2908:Dhx29 UTSW 13 112927851 missense possibly damaging 0.78
R2912:Dhx29 UTSW 13 112935575 missense probably damaging 1.00
R3414:Dhx29 UTSW 13 112947273 missense probably damaging 0.99
R3931:Dhx29 UTSW 13 112958965 missense probably damaging 1.00
R3957:Dhx29 UTSW 13 112930921 missense probably benign
R4065:Dhx29 UTSW 13 112964742 critical splice donor site probably null
R4207:Dhx29 UTSW 13 112927949 missense probably benign 0.01
R4717:Dhx29 UTSW 13 112946935 missense unknown
R4718:Dhx29 UTSW 13 112946935 missense unknown
R5125:Dhx29 UTSW 13 112932600 missense possibly damaging 0.81
R5178:Dhx29 UTSW 13 112932600 missense possibly damaging 0.81
R5263:Dhx29 UTSW 13 112948221 missense probably damaging 1.00
R5458:Dhx29 UTSW 13 112966621 missense probably benign 0.00
R5469:Dhx29 UTSW 13 112944539 missense possibly damaging 0.94
R5541:Dhx29 UTSW 13 112940374 missense possibly damaging 0.47
R5573:Dhx29 UTSW 13 112933215 missense probably benign 0.07
R5664:Dhx29 UTSW 13 112946879 missense probably damaging 1.00
R5682:Dhx29 UTSW 13 112930849 missense probably damaging 1.00
R5769:Dhx29 UTSW 13 112953717 missense probably damaging 0.99
R5917:Dhx29 UTSW 13 112962843 missense probably damaging 1.00
R5928:Dhx29 UTSW 13 112964468 missense probably benign 0.00
R6115:Dhx29 UTSW 13 112952801 critical splice acceptor site probably null
R6144:Dhx29 UTSW 13 112964571 missense probably damaging 1.00
R6195:Dhx29 UTSW 13 112964537 missense probably benign 0.08
R6233:Dhx29 UTSW 13 112964537 missense probably benign 0.08
R6430:Dhx29 UTSW 13 112944619 missense possibly damaging 0.77
R6480:Dhx29 UTSW 13 112953788 nonsense probably null
R6527:Dhx29 UTSW 13 112932542 missense probably damaging 1.00
R6856:Dhx29 UTSW 13 112952861 missense probably benign 0.43
R7391:Dhx29 UTSW 13 112962859 missense probably benign
R7555:Dhx29 UTSW 13 112927642 start gained probably benign
R7602:Dhx29 UTSW 13 112944559 missense possibly damaging 0.95
R8744:Dhx29 UTSW 13 112952884 missense possibly damaging 0.54
R9281:Dhx29 UTSW 13 112941706 missense possibly damaging 0.82
R9450:Dhx29 UTSW 13 112947328 missense possibly damaging 0.78
R9496:Dhx29 UTSW 13 112952926 missense probably damaging 1.00
R9716:Dhx29 UTSW 13 112945078 missense possibly damaging 0.83
Z1177:Dhx29 UTSW 13 112955517 missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- GAAGACCTGGCACCTGTTAG -3'
(R):5'- AGTTCCCGAGAGCAAAGCAG -3'

Sequencing Primer
(F):5'- ACCTGTTAGGAGCCTCTTCAGG -3'
(R):5'- CGAGAGCAAAGCAGAGCCC -3'
Posted On 2015-07-07