Incidental Mutation 'R4422:Zfp871'
ID 327176
Institutional Source Beutler Lab
Gene Symbol Zfp871
Ensembl Gene ENSMUSG00000024298
Gene Name zinc finger protein 871
Synonyms 9030612M13Rik
MMRRC Submission 041695-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R4422 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 32771236-32788287 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 32774833 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Isoleucine at position 456 (S456I)
Ref Sequence ENSEMBL: ENSMUSP00000127178 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057501] [ENSMUST00000159086]
AlphaFold G5E905
Predicted Effect probably benign
Transcript: ENSMUST00000057501
AA Change: S437I

PolyPhen 2 Score 0.040 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000050501
Gene: ENSMUSG00000024298
AA Change: S437I

DomainStartEndE-ValueType
KRAB 1 42 1.32e0 SMART
ZnF_C2H2 174 196 5.9e-3 SMART
ZnF_C2H2 202 224 6.32e-3 SMART
ZnF_C2H2 230 252 1.47e-3 SMART
ZnF_C2H2 258 280 3.63e-3 SMART
ZnF_C2H2 286 308 1.79e-2 SMART
ZnF_C2H2 314 336 4.79e-3 SMART
ZnF_C2H2 342 364 1.69e-3 SMART
ZnF_C2H2 370 392 2.79e-4 SMART
ZnF_C2H2 398 420 1.23e-5 SMART
ZnF_C2H2 426 448 1.2e-3 SMART
ZnF_C2H2 454 476 5.42e-2 SMART
ZnF_C2H2 482 504 8.6e-5 SMART
ZnF_C2H2 510 532 5.21e-4 SMART
ZnF_C2H2 538 560 3.11e-2 SMART
ZnF_C2H2 566 588 2.86e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159086
AA Change: S456I

PolyPhen 2 Score 0.387 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000127178
Gene: ENSMUSG00000024298
AA Change: S456I

DomainStartEndE-ValueType
KRAB 4 61 2.18e-15 SMART
ZnF_C2H2 193 215 5.9e-3 SMART
ZnF_C2H2 221 243 6.32e-3 SMART
ZnF_C2H2 249 271 1.47e-3 SMART
ZnF_C2H2 277 299 3.63e-3 SMART
ZnF_C2H2 305 327 1.79e-2 SMART
ZnF_C2H2 333 355 4.79e-3 SMART
ZnF_C2H2 361 383 1.69e-3 SMART
ZnF_C2H2 389 411 2.79e-4 SMART
ZnF_C2H2 417 439 1.23e-5 SMART
ZnF_C2H2 445 467 1.2e-3 SMART
ZnF_C2H2 473 495 5.42e-2 SMART
ZnF_C2H2 501 523 8.6e-5 SMART
ZnF_C2H2 529 551 5.21e-4 SMART
ZnF_C2H2 557 579 3.11e-2 SMART
ZnF_C2H2 585 607 2.86e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168337
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 96% (67/70)
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts13 T C 2: 27,005,400 S1168P probably benign Het
Adgrf2 T C 17: 42,713,155 M142V probably benign Het
Akna G T 4: 63,387,093 Q479K possibly damaging Het
Arhgef9 T G X: 95,101,064 I131L possibly damaging Het
AW551984 A T 9: 39,600,077 C111S probably null Het
Bak1 C A 17: 27,021,324 G130W probably damaging Het
Bank1 T A 3: 136,083,211 Q441L probably damaging Het
C030034I22Rik T C 17: 69,418,158 noncoding transcript Het
Capns2 T A 8: 92,901,624 I47N possibly damaging Het
Cct7 A G 6: 85,467,145 R355G probably damaging Het
Cd19 C T 7: 126,413,406 V272I probably benign Het
Cenpf A G 1: 189,658,350 L1095S probably damaging Het
Cep44 G A 8: 56,538,617 P317S probably benign Het
Chrm3 A T 13: 9,878,555 Y148* probably null Het
Chrnb3 T C 8: 27,396,733 V445A possibly damaging Het
Col4a4 T A 1: 82,489,838 M852L unknown Het
Dhx29 T C 13: 112,947,247 L612P probably damaging Het
Dlgap2 T C 8: 14,743,463 probably null Het
Dnah17 T C 11: 118,081,973 T2045A possibly damaging Het
Dync1li1 A G 9: 114,709,309 T245A probably damaging Het
Epha4 T C 1: 77,511,717 E42G probably damaging Het
Fam120b C A 17: 15,402,183 T141K probably damaging Het
Fhod1 T C 8: 105,337,351 probably benign Het
Gcnt2 T G 13: 40,860,525 Y57* probably null Het
Gm5409 C T 6: 41,419,585 noncoding transcript Het
Hip1r A G 5: 123,997,006 K402E possibly damaging Het
Hlcs G A 16: 94,138,960 P506L possibly damaging Het
Itih4 T A 14: 30,889,864 F142I probably damaging Het
Krt78 T C 15: 101,947,940 T479A probably benign Het
Lamb2 A G 9: 108,483,555 D518G probably damaging Het
Ldlr G A 9: 21,737,952 C341Y probably damaging Het
Lsr G T 7: 30,965,997 N177K probably benign Het
Macf1 G A 4: 123,466,046 S1815F probably damaging Het
Mms22l T C 4: 24,503,008 S95P probably damaging Het
Mon2 A G 10: 123,042,982 L218P probably damaging Het
Nlrp4f C T 13: 65,184,962 probably null Het
Nrde2 G A 12: 100,146,027 Q137* probably null Het
Olfr1145 C A 2: 87,810,645 T275K probably damaging Het
Olfr5 G T 7: 6,481,038 Y39* probably null Het
Olfr606 G T 7: 103,452,243 R302L probably damaging Het
Phf24 G A 4: 42,934,817 C151Y probably damaging Het
Pik3r1 T G 13: 101,694,384 N3T probably benign Het
Plcb2 T C 2: 118,712,003 K821E probably benign Het
Ppat A G 5: 76,915,214 W517R probably damaging Het
Prelid2 T C 18: 41,912,396 T150A probably benign Het
Psg21 A G 7: 18,647,332 S429P probably damaging Het
Reg4 T C 3: 98,233,044 Y114H possibly damaging Het
Rsbn1l G T 5: 20,896,546 H665Q probably damaging Het
Rspo2 T C 15: 43,169,754 N24S probably benign Het
Ryr2 G T 13: 11,717,066 C2329* probably null Het
Skint2 T A 4: 112,584,588 probably benign Het
Syvn1 C T 19: 6,049,921 probably benign Het
Thegl T C 5: 77,054,536 I268T possibly damaging Het
Tmem53 T C 4: 117,265,952 Y37H probably damaging Het
Tmem59l G A 8: 70,486,099 R111W probably damaging Het
Tnks2 G A 19: 36,845,653 V107I probably damaging Het
Tpcn1 T C 5: 120,542,518 K549R probably damaging Het
Tubgcp4 T A 2: 121,189,401 L404* probably null Het
Vmn2r86 T C 10: 130,452,976 I219V possibly damaging Het
Vsig10 T C 5: 117,324,921 S71P probably benign Het
Wnk1 T C 6: 119,953,895 N896S probably benign Het
Zfp873 A G 10: 82,060,874 T480A probably benign Het
Other mutations in Zfp871
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00849:Zfp871 APN 17 32775899 missense probably benign
IGL00963:Zfp871 APN 17 32774752 missense probably benign 0.25
IGL01687:Zfp871 APN 17 32775644 missense probably benign 0.00
IGL02170:Zfp871 APN 17 32775688 missense possibly damaging 0.72
IGL02399:Zfp871 APN 17 32774355 missense probably benign 0.18
R0304:Zfp871 UTSW 17 32774434 missense probably damaging 0.99
R1215:Zfp871 UTSW 17 32775972 missense possibly damaging 0.70
R1444:Zfp871 UTSW 17 32774926 missense possibly damaging 0.85
R1754:Zfp871 UTSW 17 32775334 missense probably damaging 1.00
R1913:Zfp871 UTSW 17 32775917 missense possibly damaging 0.53
R2018:Zfp871 UTSW 17 32774777 missense probably damaging 1.00
R2180:Zfp871 UTSW 17 32775301 missense probably damaging 1.00
R2881:Zfp871 UTSW 17 32775433 missense probably damaging 1.00
R4422:Zfp871 UTSW 17 32774834 missense probably benign 0.37
R4979:Zfp871 UTSW 17 32775855 missense probably damaging 0.99
R5564:Zfp871 UTSW 17 32775868 missense possibly damaging 0.70
R6228:Zfp871 UTSW 17 32775884 missense possibly damaging 0.50
R6232:Zfp871 UTSW 17 32775520 frame shift probably null
R6233:Zfp871 UTSW 17 32775520 frame shift probably null
R6234:Zfp871 UTSW 17 32775520 frame shift probably null
R6474:Zfp871 UTSW 17 32775673 missense possibly damaging 0.85
R7237:Zfp871 UTSW 17 32775315 missense probably damaging 1.00
R7809:Zfp871 UTSW 17 32774852 missense probably damaging 1.00
R8830:Zfp871 UTSW 17 32774927 missense probably benign 0.03
R9219:Zfp871 UTSW 17 32774940 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- ACCTCGAGGAAGTGAAGCTC -3'
(R):5'- GATTCACACTGGGGAGAGAC -3'

Sequencing Primer
(F):5'- GAAGTGAAGCTCTTCCCACACTG -3'
(R):5'- AGACCCTATGTGTGTGACCAG -3'
Posted On 2015-07-07