Incidental Mutation 'R0016:Dach1'
ID32719
Institutional Source Beutler Lab
Gene Symbol Dach1
Ensembl Gene ENSMUSG00000055639
Gene Namedachshund family transcription factor 1
SynonymsDac, E130112M23Rik
MMRRC Submission 038311-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0016 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location97786853-98169765 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 98168748 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 188 (G188R)
Ref Sequence ENSEMBL: ENSMUSP00000071464 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069334] [ENSMUST00000071533]
Predicted Effect probably damaging
Transcript: ENSMUST00000069334
AA Change: G188R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000064970
Gene: ENSMUSG00000055639
AA Change: G188R

DomainStartEndE-ValueType
low complexity region 7 53 N/A INTRINSIC
low complexity region 61 97 N/A INTRINSIC
low complexity region 102 156 N/A INTRINSIC
Pfam:Ski_Sno 159 275 4.8e-53 PFAM
low complexity region 318 334 N/A INTRINSIC
low complexity region 443 470 N/A INTRINSIC
SCOP:d1eq1a_ 556 674 1e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000071533
AA Change: G188R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000071464
Gene: ENSMUSG00000055639
AA Change: G188R

DomainStartEndE-ValueType
low complexity region 7 53 N/A INTRINSIC
low complexity region 61 97 N/A INTRINSIC
low complexity region 102 156 N/A INTRINSIC
Pfam:Ski_Sno 164 274 6.5e-42 PFAM
low complexity region 318 334 N/A INTRINSIC
low complexity region 495 522 N/A INTRINSIC
SCOP:d1eq1a_ 608 726 6e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156684
Meta Mutation Damage Score 0.4084 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 93.2%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a chromatin-associated protein that associates with other DNA-binding transcription factors to regulate gene expression and cell fate determination during development. The protein contains a Ski domain that is highly conserved from Drosophila to human. Expression of this gene is lost in some forms of metastatic cancer, and is correlated with poor prognosis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009]
PHENOTYPE: In spite of normal gross morphology, mice homozygous for targeted mutations that inactivate this gene die within 1 day of birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 A C 1: 71,294,800 V1181G probably benign Het
Adamts12 A T 15: 11,217,829 I291F probably damaging Het
Aspm G C 1: 139,479,544 Q2056H probably benign Het
BC067074 T C 13: 113,366,105 Y115H probably damaging Het
C7 A T 15: 5,046,924 V122E probably benign Het
Casp12 A T 9: 5,352,844 Q152L probably null Het
Cdh16 T A 8: 104,617,632 T92S probably benign Het
Chrd G C 16: 20,734,308 V162L possibly damaging Het
Cpne8 A G 15: 90,501,405 probably benign Het
Cyp2j7 T A 4: 96,202,147 I347F probably damaging Het
Cyp4a10 A T 4: 115,521,107 Q130L probably damaging Het
Dgkd T C 1: 87,917,952 S294P probably benign Het
Dnah8 A G 17: 30,663,316 I621V probably benign Het
Dync2h1 A G 9: 7,144,346 probably benign Het
Echdc1 A T 10: 29,322,421 probably benign Het
Elovl3 T A 19: 46,132,158 F30Y probably damaging Het
Fa2h T C 8: 111,393,514 Y80C probably damaging Het
Fam208b A C 13: 3,585,170 probably null Het
Fgd3 C T 13: 49,296,609 D55N probably benign Het
Fhod1 T C 8: 105,331,655 E823G possibly damaging Het
Gapvd1 A G 2: 34,699,913 probably benign Het
Gm17067 A T 7: 42,708,622 I152K probably benign Het
Gm1966 G A 7: 106,603,246 L264F probably benign Het
Gm9833 A T 3: 10,089,319 M383L possibly damaging Het
Kif27 A G 13: 58,354,714 V50A probably damaging Het
Kpna2 T C 11: 106,991,086 T305A probably benign Het
Krtap22-2 A G 16: 89,010,519 probably benign Het
Lrp2bp T A 8: 46,012,031 F62L probably damaging Het
Marf1 G A 16: 14,152,265 H197Y probably damaging Het
Mob3b A G 4: 35,083,947 F81L probably benign Het
Mon2 C T 10: 123,035,546 V389M probably damaging Het
Myh8 A G 11: 67,298,525 K1176E probably damaging Het
Naf1 T C 8: 66,889,055 probably benign Het
Nckap1l A G 15: 103,475,636 T554A probably benign Het
Oog3 A G 4: 144,158,071 Y432H probably damaging Het
Paxbp1 A T 16: 91,036,036 probably benign Het
Phf20 A T 2: 156,267,194 K154* probably null Het
Plekhj1 T C 10: 80,796,416 D74G possibly damaging Het
Plpp4 T C 7: 129,323,424 C128R probably damaging Het
Rcan3 A T 4: 135,418,378 probably null Het
Sh3rf1 T A 8: 61,374,138 M642K probably benign Het
Slc7a1 A G 5: 148,334,583 V522A probably benign Het
Sorbs1 A G 19: 40,314,738 probably benign Het
Spry2 C T 14: 105,893,297 V152M probably benign Het
Srgap2 A G 1: 131,349,462 M349T possibly damaging Het
Stag3 A G 5: 138,291,381 H271R possibly damaging Het
Stat4 T C 1: 52,068,780 V136A probably benign Het
Stc2 A T 11: 31,360,177 D286E probably benign Het
Stk31 T C 6: 49,437,377 Y482H probably damaging Het
Ticrr C T 7: 79,693,792 P1135L probably benign Het
Tmem55b C T 14: 50,928,894 R213Q probably damaging Het
Trim27 A T 13: 21,191,229 E310V probably benign Het
Uvrag T C 7: 98,991,981 K284R probably benign Het
Vmn1r78 A C 7: 12,153,352 S297R probably benign Het
Xylt2 A G 11: 94,669,640 S270P probably damaging Het
Zfhx3 T C 8: 108,950,178 M2620T probably benign Het
Zkscan2 C A 7: 123,499,996 probably benign Het
Zwint T C 10: 72,657,198 probably benign Het
Other mutations in Dach1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00780:Dach1 APN 14 97901422 missense possibly damaging 0.83
IGL01101:Dach1 APN 14 97840204 missense possibly damaging 0.83
IGL02033:Dach1 APN 14 97901429 missense possibly damaging 0.82
IGL02116:Dach1 APN 14 97901423 missense probably damaging 0.98
IGL02583:Dach1 APN 14 97828394 splice site probably benign
IGL02937:Dach1 APN 14 97915795 critical splice donor site probably null
IGL03120:Dach1 APN 14 97827789 missense probably damaging 1.00
R0017:Dach1 UTSW 14 98168748 missense probably damaging 1.00
R0117:Dach1 UTSW 14 98168748 missense probably damaging 1.00
R0334:Dach1 UTSW 14 98168748 missense probably damaging 1.00
R0336:Dach1 UTSW 14 98168748 missense probably damaging 1.00
R0371:Dach1 UTSW 14 97969903 missense probably damaging 0.99
R0511:Dach1 UTSW 14 97901329 missense possibly damaging 0.94
R0538:Dach1 UTSW 14 97903279 missense possibly damaging 0.80
R0799:Dach1 UTSW 14 98168615 missense possibly damaging 0.79
R0928:Dach1 UTSW 14 97915832 missense probably damaging 0.98
R0939:Dach1 UTSW 14 97915924 missense probably damaging 0.99
R1512:Dach1 UTSW 14 97901399 missense probably damaging 0.99
R1646:Dach1 UTSW 14 98169114 missense unknown
R1865:Dach1 UTSW 14 97840209 missense possibly damaging 0.68
R1881:Dach1 UTSW 14 97901396 missense probably benign 0.20
R1909:Dach1 UTSW 14 97901393 missense probably damaging 1.00
R1980:Dach1 UTSW 14 97831341 missense probably damaging 1.00
R2215:Dach1 UTSW 14 98168481 critical splice donor site probably null
R2570:Dach1 UTSW 14 97901411 missense probably benign 0.17
R3924:Dach1 UTSW 14 97915903 missense probably damaging 1.00
R3957:Dach1 UTSW 14 97840109 missense probably damaging 0.99
R4095:Dach1 UTSW 14 97901379 missense possibly damaging 0.92
R4373:Dach1 UTSW 14 97827750 missense possibly damaging 0.94
R5350:Dach1 UTSW 14 97969959 missense probably damaging 1.00
R5428:Dach1 UTSW 14 98169269 missense unknown
R5818:Dach1 UTSW 14 98168684 missense probably damaging 1.00
R6824:Dach1 UTSW 14 98018892 missense possibly damaging 0.81
R6967:Dach1 UTSW 14 97903197 missense probably damaging 1.00
R7263:Dach1 UTSW 14 98168859 missense probably benign
R7701:Dach1 UTSW 14 97903234 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGTTCCACATTGCACACCACCG -3'
(R):5'- GGCTTTGATCCCTCCGACCCAG -3'

Sequencing Primer
(F):5'- ACCGGCGTGATCTCCAAC -3'
(R):5'- gcgggagcaactgcaac -3'
Posted On2013-05-09