Incidental Mutation 'R4423:Far1'
ID327205
Institutional Source Beutler Lab
Gene Symbol Far1
Ensembl Gene ENSMUSG00000030759
Gene Namefatty acyl CoA reductase 1
SynonymsMlstd2, 3732409C05Rik, 2600011M19Rik, 2900034E22Rik
MMRRC Submission 041143-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.732) question?
Stock #R4423 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location113513834-113571511 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 113540598 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 84 (S84R)
Ref Sequence ENSEMBL: ENSMUSP00000117131 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033018] [ENSMUST00000067929] [ENSMUST00000122890] [ENSMUST00000129087] [ENSMUST00000136158] [ENSMUST00000164745]
Predicted Effect possibly damaging
Transcript: ENSMUST00000033018
AA Change: S84R

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000033018
Gene: ENSMUSG00000030759
AA Change: S84R

DomainStartEndE-ValueType
Pfam:Epimerase 13 177 1e-8 PFAM
Pfam:NAD_binding_4 15 285 3.2e-80 PFAM
Pfam:Sterile 356 448 3.1e-34 PFAM
transmembrane domain 466 483 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000067929
AA Change: S84R

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000064334
Gene: ENSMUSG00000030759
AA Change: S84R

DomainStartEndE-ValueType
Pfam:Epimerase 13 177 1e-8 PFAM
Pfam:NAD_binding_4 15 285 3.2e-80 PFAM
Pfam:Sterile 356 448 5.4e-36 PFAM
transmembrane domain 466 483 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000122890
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123845
Predicted Effect probably damaging
Transcript: ENSMUST00000129087
AA Change: S84R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117131
Gene: ENSMUSG00000030759
AA Change: S84R

DomainStartEndE-ValueType
Pfam:Polysacc_synt_2 13 159 1.5e-7 PFAM
Pfam:Epimerase 13 174 8.5e-10 PFAM
Pfam:NAD_binding_4 15 180 9.7e-52 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000136158
AA Change: S84R

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000122643
Gene: ENSMUSG00000030759
AA Change: S84R

DomainStartEndE-ValueType
Pfam:Polysacc_synt_2 13 159 2.3e-7 PFAM
Pfam:Epimerase 13 174 1.3e-9 PFAM
Pfam:NAD_binding_4 15 207 7.6e-54 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138253
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156875
Predicted Effect possibly damaging
Transcript: ENSMUST00000164745
AA Change: S84R

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000128695
Gene: ENSMUSG00000030759
AA Change: S84R

DomainStartEndE-ValueType
Pfam:Epimerase 13 241 1.5e-10 PFAM
Pfam:NAD_binding_4 15 285 9.9e-78 PFAM
Pfam:Sterile 355 448 5.8e-26 PFAM
transmembrane domain 466 483 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is required for the reduction of fatty acids to fatty alcohols, a process that is required for the synthesis of monoesters and ether lipids. NADPH is required as a cofactor in this reaction, and 16-18 carbon saturated and unsaturated fatty acids are the preferred substrate. This is a peroxisomal membrane protein, and studies suggest that the N-terminus contains a large catalytic domain located on the outside of the peroxisome, while the C-terminus is exposed to the matrix of the peroxisome. Studies indicate that the regulation of this protein is dependent on plasmalogen levels. Mutations in this gene have been associated with individuals affected by severe intellectual disability, early-onset epilepsy, microcephaly, congenital cataracts, growth retardation, and spasticity (PMID: 25439727). A pseudogene of this gene is located on chromosome 13. [provided by RefSeq, Jan 2015]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik C A 10: 100,605,633 P100Q probably damaging Het
A630010A05Rik A G 16: 14,618,713 Y210C probably benign Het
Arfgap1 C A 2: 180,981,076 D327E probably benign Het
Arhgef9 T G X: 95,101,064 I131L possibly damaging Het
Asgr2 G A 11: 70,105,385 V218I probably benign Het
Capns2 T A 8: 92,901,624 I47N possibly damaging Het
Cep44 G A 8: 56,538,617 P317S probably benign Het
Cnot10 T A 9: 114,617,920 I363F probably damaging Het
Coch T A 12: 51,598,149 probably null Het
Dnah1 C T 14: 31,284,761 G2199D probably benign Het
Dock9 A G 14: 121,562,053 probably null Het
Dst T C 1: 34,188,393 I1689T possibly damaging Het
Eif2ak4 T C 2: 118,439,066 F762S probably benign Het
Eif2b5 A G 16: 20,501,719 D195G probably benign Het
Elmo1 C G 13: 20,600,212 Y646* probably null Het
Fam183b A T 11: 58,796,531 probably null Het
Fhod1 T C 8: 105,337,351 probably benign Het
Galnt15 A T 14: 32,058,269 I508F possibly damaging Het
Grik1 T C 16: 87,923,200 T745A probably benign Het
Hira A G 16: 18,956,202 D959G possibly damaging Het
Hsf5 T C 11: 87,631,634 L351P probably damaging Het
Icosl C T 10: 78,071,873 T89I possibly damaging Het
Iws1 T A 18: 32,083,450 N414K probably damaging Het
Kif1b A G 4: 149,214,105 S1035P probably damaging Het
Lcp2 G T 11: 34,078,226 probably benign Het
Map4 C T 9: 110,067,594 T631I probably damaging Het
Nepn T A 10: 52,391,815 I59N probably damaging Het
Nin T A 12: 70,042,978 K1221M probably damaging Het
Nup155 A G 15: 8,121,464 T333A probably damaging Het
Olfr651 T C 7: 104,553,345 V142A probably benign Het
Olfr902 A G 9: 38,449,366 T165A probably benign Het
Olfr961 A G 9: 39,647,116 Y130C probably damaging Het
Plod2 T C 9: 92,601,989 L502S probably benign Het
Pnpt1 A G 11: 29,153,375 probably null Het
Ppat A G 5: 76,915,214 W517R probably damaging Het
Ppp1r16b C T 2: 158,757,254 T382I probably benign Het
Prkcq T C 2: 11,256,169 I344T possibly damaging Het
Rbl1 A G 2: 157,168,955 probably benign Het
Rpl31-ps17 C T 12: 54,701,612 noncoding transcript Het
Sec62 T C 3: 30,814,282 M220T unknown Het
Shprh T G 10: 11,186,518 V1219G possibly damaging Het
Slc25a46 T C 18: 31,609,598 T72A probably benign Het
Slc4a2 G A 5: 24,439,848 W1040* probably null Het
Slc5a1 T C 5: 33,154,674 V470A possibly damaging Het
Syvn1 C T 19: 6,049,921 probably benign Het
Tex47 G T 5: 7,305,364 A182S probably benign Het
Thegl T C 5: 77,054,536 I268T possibly damaging Het
Top2a A G 11: 99,001,405 I1077T probably benign Het
Tpcn1 T C 5: 120,542,518 K549R probably damaging Het
Trpm2 T C 10: 77,935,068 D678G probably benign Het
Ube3a T C 7: 59,276,113 I234T probably benign Het
Vmn2r57 T C 7: 41,426,640 K483E probably damaging Het
Wnk1 T A 6: 119,926,426 S2111C probably damaging Het
Zcchc6 T C 13: 59,822,049 K11E probably damaging Het
Other mutations in Far1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00815:Far1 APN 7 113540689 missense probably benign 0.07
IGL02597:Far1 APN 7 113551256 missense probably benign 0.31
IGL02937:Far1 APN 7 113540648 missense probably damaging 0.98
R0499:Far1 UTSW 7 113554296 intron probably benign
R2045:Far1 UTSW 7 113539271 critical splice acceptor site probably null
R2140:Far1 UTSW 7 113566460 missense possibly damaging 0.89
R2852:Far1 UTSW 7 113553737 missense possibly damaging 0.95
R2853:Far1 UTSW 7 113553737 missense possibly damaging 0.95
R4426:Far1 UTSW 7 113550001 missense probably benign 0.08
R4801:Far1 UTSW 7 113539453 missense possibly damaging 0.77
R4802:Far1 UTSW 7 113539453 missense possibly damaging 0.77
R4898:Far1 UTSW 7 113568225 missense probably damaging 1.00
R5762:Far1 UTSW 7 113568189 missense probably damaging 0.98
R6151:Far1 UTSW 7 113561396 missense possibly damaging 0.60
R6165:Far1 UTSW 7 113554218 missense probably benign
R6278:Far1 UTSW 7 113568137 missense probably benign 0.00
R7269:Far1 UTSW 7 113561447 missense probably benign 0.00
R7356:Far1 UTSW 7 113568142 missense possibly damaging 0.94
R7853:Far1 UTSW 7 113554148 missense probably damaging 1.00
R7936:Far1 UTSW 7 113554148 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGTCTTCTGTGCCCCATGAAATC -3'
(R):5'- ATGACAATTTCGCATCACTCTC -3'

Sequencing Primer
(F):5'- CTGTGCCCCATGAAATCTAAAATG -3'
(R):5'- TTTCGCATCACTCTCAAAACAACTTC -3'
Posted On2015-07-07