Incidental Mutation 'R4423:Fhod1'
ID327208
Institutional Source Beutler Lab
Gene Symbol Fhod1
Ensembl Gene ENSMUSG00000014778
Gene Nameformin homology 2 domain containing 1
Synonyms
MMRRC Submission 041143-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.325) question?
Stock #R4423 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location105329163-105347953 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 105337351 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000104997 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014922] [ENSMUST00000098453] [ENSMUST00000109372]
Predicted Effect unknown
Transcript: ENSMUST00000014922
AA Change: I241V
SMART Domains Protein: ENSMUSP00000014922
Gene: ENSMUSG00000014778
AA Change: I241V

DomainStartEndE-ValueType
PDB:3DAD|B 1 339 N/A PDB
Blast:Drf_GBD 85 216 1e-48 BLAST
SCOP:d1ee4a_ 120 240 4e-4 SMART
Blast:FH2 231 318 6e-38 BLAST
low complexity region 342 357 N/A INTRINSIC
Blast:FH2 386 483 2e-10 BLAST
low complexity region 514 532 N/A INTRINSIC
low complexity region 573 643 N/A INTRINSIC
FH2 648 1100 3.16e-121 SMART
low complexity region 1119 1130 N/A INTRINSIC
Blast:FH2 1135 1179 1e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000098453
SMART Domains Protein: ENSMUSP00000096052
Gene: ENSMUSG00000014856

DomainStartEndE-ValueType
Pfam:DUF788 7 103 3.7e-29 PFAM
low complexity region 118 133 N/A INTRINSIC
low complexity region 135 149 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109372
SMART Domains Protein: ENSMUSP00000104997
Gene: ENSMUSG00000014856

DomainStartEndE-ValueType
Pfam:DUF788 7 103 4.2e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132777
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136439
Meta Mutation Damage Score 0.0824 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 100% (57/57)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik C A 10: 100,605,633 P100Q probably damaging Het
A630010A05Rik A G 16: 14,618,713 Y210C probably benign Het
Arfgap1 C A 2: 180,981,076 D327E probably benign Het
Arhgef9 T G X: 95,101,064 I131L possibly damaging Het
Asgr2 G A 11: 70,105,385 V218I probably benign Het
Capns2 T A 8: 92,901,624 I47N possibly damaging Het
Cep44 G A 8: 56,538,617 P317S probably benign Het
Cnot10 T A 9: 114,617,920 I363F probably damaging Het
Coch T A 12: 51,598,149 probably null Het
Dnah1 C T 14: 31,284,761 G2199D probably benign Het
Dock9 A G 14: 121,562,053 probably null Het
Dst T C 1: 34,188,393 I1689T possibly damaging Het
Eif2ak4 T C 2: 118,439,066 F762S probably benign Het
Eif2b5 A G 16: 20,501,719 D195G probably benign Het
Elmo1 C G 13: 20,600,212 Y646* probably null Het
Fam183b A T 11: 58,796,531 probably null Het
Far1 T A 7: 113,540,598 S84R probably damaging Het
Galnt15 A T 14: 32,058,269 I508F possibly damaging Het
Grik1 T C 16: 87,923,200 T745A probably benign Het
Hira A G 16: 18,956,202 D959G possibly damaging Het
Hsf5 T C 11: 87,631,634 L351P probably damaging Het
Icosl C T 10: 78,071,873 T89I possibly damaging Het
Iws1 T A 18: 32,083,450 N414K probably damaging Het
Kif1b A G 4: 149,214,105 S1035P probably damaging Het
Lcp2 G T 11: 34,078,226 probably benign Het
Map4 C T 9: 110,067,594 T631I probably damaging Het
Nepn T A 10: 52,391,815 I59N probably damaging Het
Nin T A 12: 70,042,978 K1221M probably damaging Het
Nup155 A G 15: 8,121,464 T333A probably damaging Het
Olfr651 T C 7: 104,553,345 V142A probably benign Het
Olfr902 A G 9: 38,449,366 T165A probably benign Het
Olfr961 A G 9: 39,647,116 Y130C probably damaging Het
Plod2 T C 9: 92,601,989 L502S probably benign Het
Pnpt1 A G 11: 29,153,375 probably null Het
Ppat A G 5: 76,915,214 W517R probably damaging Het
Ppp1r16b C T 2: 158,757,254 T382I probably benign Het
Prkcq T C 2: 11,256,169 I344T possibly damaging Het
Rbl1 A G 2: 157,168,955 probably benign Het
Rpl31-ps17 C T 12: 54,701,612 noncoding transcript Het
Sec62 T C 3: 30,814,282 M220T unknown Het
Shprh T G 10: 11,186,518 V1219G possibly damaging Het
Slc25a46 T C 18: 31,609,598 T72A probably benign Het
Slc4a2 G A 5: 24,439,848 W1040* probably null Het
Slc5a1 T C 5: 33,154,674 V470A possibly damaging Het
Syvn1 C T 19: 6,049,921 probably benign Het
Tex47 G T 5: 7,305,364 A182S probably benign Het
Thegl T C 5: 77,054,536 I268T possibly damaging Het
Top2a A G 11: 99,001,405 I1077T probably benign Het
Tpcn1 T C 5: 120,542,518 K549R probably damaging Het
Trpm2 T C 10: 77,935,068 D678G probably benign Het
Ube3a T C 7: 59,276,113 I234T probably benign Het
Vmn2r57 T C 7: 41,426,640 K483E probably damaging Het
Wnk1 T A 6: 119,926,426 S2111C probably damaging Het
Zcchc6 T C 13: 59,822,049 K11E probably damaging Het
Other mutations in Fhod1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00970:Fhod1 APN 8 105332102 missense possibly damaging 0.66
IGL01149:Fhod1 APN 8 105347807 unclassified probably benign
IGL01325:Fhod1 APN 8 105331649 missense probably benign 0.33
IGL01470:Fhod1 APN 8 105329649 missense probably damaging 1.00
IGL01521:Fhod1 APN 8 105330423 missense probably benign 0.17
IGL01861:Fhod1 APN 8 105331176 missense probably damaging 1.00
IGL02864:Fhod1 APN 8 105337164 unclassified probably benign
IGL02951:Fhod1 APN 8 105331230 missense probably damaging 1.00
reactive UTSW 8 105336434 unclassified probably benign
treason UTSW 8 105337350 unclassified probably benign
R0016:Fhod1 UTSW 8 105331655 missense possibly damaging 0.91
R0016:Fhod1 UTSW 8 105331655 missense possibly damaging 0.91
R0071:Fhod1 UTSW 8 105337225 splice site probably null
R0071:Fhod1 UTSW 8 105337225 splice site probably null
R0498:Fhod1 UTSW 8 105329856 missense probably damaging 1.00
R1234:Fhod1 UTSW 8 105337163 unclassified probably benign
R1465:Fhod1 UTSW 8 105338914 unclassified probably benign
R1465:Fhod1 UTSW 8 105338914 unclassified probably benign
R1485:Fhod1 UTSW 8 105336798 critical splice acceptor site probably null
R1585:Fhod1 UTSW 8 105337325 unclassified probably benign
R1615:Fhod1 UTSW 8 105347831 unclassified probably benign
R1778:Fhod1 UTSW 8 105329677 missense probably damaging 1.00
R1781:Fhod1 UTSW 8 105347789 unclassified probably benign
R2291:Fhod1 UTSW 8 105336964 unclassified probably benign
R2864:Fhod1 UTSW 8 105332911 missense probably null 0.97
R2865:Fhod1 UTSW 8 105332911 missense probably null 0.97
R3775:Fhod1 UTSW 8 105331638 unclassified probably benign
R4107:Fhod1 UTSW 8 105338038 unclassified probably benign
R4422:Fhod1 UTSW 8 105337351 unclassified probably benign
R4424:Fhod1 UTSW 8 105337351 unclassified probably benign
R4425:Fhod1 UTSW 8 105337351 unclassified probably benign
R4641:Fhod1 UTSW 8 105329592 missense probably damaging 1.00
R4724:Fhod1 UTSW 8 105337861 unclassified probably benign
R4757:Fhod1 UTSW 8 105347811 unclassified probably benign
R5004:Fhod1 UTSW 8 105336945 unclassified probably benign
R5082:Fhod1 UTSW 8 105330513 missense probably damaging 1.00
R6033:Fhod1 UTSW 8 105336434 unclassified probably benign
R6033:Fhod1 UTSW 8 105336434 unclassified probably benign
R6298:Fhod1 UTSW 8 105337148 unclassified probably benign
R6320:Fhod1 UTSW 8 105337350 unclassified probably benign
R6362:Fhod1 UTSW 8 105331641 critical splice donor site probably null
R6449:Fhod1 UTSW 8 105330237 missense probably damaging 1.00
R6736:Fhod1 UTSW 8 105337890 unclassified probably benign
R6816:Fhod1 UTSW 8 105330544 missense probably benign 0.10
R6955:Fhod1 UTSW 8 105333007 missense probably benign 0.00
R7073:Fhod1 UTSW 8 105337139 missense unknown
R7567:Fhod1 UTSW 8 105347837 missense unknown
Predicted Primers PCR Primer
(F):5'- AGAGTGACAGTGTACACCAAC -3'
(R):5'- AGGGTCTTCCTACATCTTCGG -3'

Sequencing Primer
(F):5'- GTGACAGTGTACACCAACAACTCTG -3'
(R):5'- ATCTTCGGATCCAGCCCCAG -3'
Posted On2015-07-07