Incidental Mutation 'R4423:Olfr902'
ID327209
Institutional Source Beutler Lab
Gene Symbol Olfr902
Ensembl Gene ENSMUSG00000049334
Gene Nameolfactory receptor 902
SynonymsGA_x6K02T2PVTD-32141623-32142552, MOR169-1
MMRRC Submission 041143-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R4423 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location38447652-38450576 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 38449366 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 165 (T165A)
Ref Sequence ENSEMBL: ENSMUSP00000151061 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050733] [ENSMUST00000213105]
Predicted Effect probably benign
Transcript: ENSMUST00000050733
AA Change: T165A

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000055975
Gene: ENSMUSG00000049334
AA Change: T165A

DomainStartEndE-ValueType
Pfam:7tm_4 31 306 1.5e-48 PFAM
Pfam:7tm_1 41 289 1.2e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213105
AA Change: T165A

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik C A 10: 100,605,633 P100Q probably damaging Het
A630010A05Rik A G 16: 14,618,713 Y210C probably benign Het
Arfgap1 C A 2: 180,981,076 D327E probably benign Het
Arhgef9 T G X: 95,101,064 I131L possibly damaging Het
Asgr2 G A 11: 70,105,385 V218I probably benign Het
Capns2 T A 8: 92,901,624 I47N possibly damaging Het
Cep44 G A 8: 56,538,617 P317S probably benign Het
Cnot10 T A 9: 114,617,920 I363F probably damaging Het
Coch T A 12: 51,598,149 probably null Het
Dnah1 C T 14: 31,284,761 G2199D probably benign Het
Dock9 A G 14: 121,562,053 probably null Het
Dst T C 1: 34,188,393 I1689T possibly damaging Het
Eif2ak4 T C 2: 118,439,066 F762S probably benign Het
Eif2b5 A G 16: 20,501,719 D195G probably benign Het
Elmo1 C G 13: 20,600,212 Y646* probably null Het
Fam183b A T 11: 58,796,531 probably null Het
Far1 T A 7: 113,540,598 S84R probably damaging Het
Fhod1 T C 8: 105,337,351 probably benign Het
Galnt15 A T 14: 32,058,269 I508F possibly damaging Het
Grik1 T C 16: 87,923,200 T745A probably benign Het
Hira A G 16: 18,956,202 D959G possibly damaging Het
Hsf5 T C 11: 87,631,634 L351P probably damaging Het
Icosl C T 10: 78,071,873 T89I possibly damaging Het
Iws1 T A 18: 32,083,450 N414K probably damaging Het
Kif1b A G 4: 149,214,105 S1035P probably damaging Het
Lcp2 G T 11: 34,078,226 probably benign Het
Map4 C T 9: 110,067,594 T631I probably damaging Het
Nepn T A 10: 52,391,815 I59N probably damaging Het
Nin T A 12: 70,042,978 K1221M probably damaging Het
Nup155 A G 15: 8,121,464 T333A probably damaging Het
Olfr651 T C 7: 104,553,345 V142A probably benign Het
Olfr961 A G 9: 39,647,116 Y130C probably damaging Het
Plod2 T C 9: 92,601,989 L502S probably benign Het
Pnpt1 A G 11: 29,153,375 probably null Het
Ppat A G 5: 76,915,214 W517R probably damaging Het
Ppp1r16b C T 2: 158,757,254 T382I probably benign Het
Prkcq T C 2: 11,256,169 I344T possibly damaging Het
Rbl1 A G 2: 157,168,955 probably benign Het
Rpl31-ps17 C T 12: 54,701,612 noncoding transcript Het
Sec62 T C 3: 30,814,282 M220T unknown Het
Shprh T G 10: 11,186,518 V1219G possibly damaging Het
Slc25a46 T C 18: 31,609,598 T72A probably benign Het
Slc4a2 G A 5: 24,439,848 W1040* probably null Het
Slc5a1 T C 5: 33,154,674 V470A possibly damaging Het
Syvn1 C T 19: 6,049,921 probably benign Het
Tex47 G T 5: 7,305,364 A182S probably benign Het
Thegl T C 5: 77,054,536 I268T possibly damaging Het
Top2a A G 11: 99,001,405 I1077T probably benign Het
Tpcn1 T C 5: 120,542,518 K549R probably damaging Het
Trpm2 T C 10: 77,935,068 D678G probably benign Het
Ube3a T C 7: 59,276,113 I234T probably benign Het
Vmn2r57 T C 7: 41,426,640 K483E probably damaging Het
Wnk1 T A 6: 119,926,426 S2111C probably damaging Het
Zcchc6 T C 13: 59,822,049 K11E probably damaging Het
Other mutations in Olfr902
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01738:Olfr902 APN 9 38449646 missense probably damaging 0.97
IGL02149:Olfr902 APN 9 38449397 missense probably damaging 0.97
IGL02869:Olfr902 APN 9 38449193 missense possibly damaging 0.75
IGL02945:Olfr902 APN 9 38449516 missense probably benign 0.00
IGL03269:Olfr902 APN 9 38448901 missense probably benign 0.13
R1955:Olfr902 UTSW 9 38449688 missense probably benign 0.13
R2182:Olfr902 UTSW 9 38449124 missense probably benign 0.21
R2864:Olfr902 UTSW 9 38449388 missense possibly damaging 0.89
R4938:Olfr902 UTSW 9 38449383 missense probably benign 0.10
R5537:Olfr902 UTSW 9 38449242 nonsense probably null
R6645:Olfr902 UTSW 9 38448923 missense probably damaging 1.00
R6861:Olfr902 UTSW 9 38449435 missense probably damaging 1.00
R6951:Olfr902 UTSW 9 38448938 missense probably benign 0.00
R7568:Olfr902 UTSW 9 38449646 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGCAATGTATGACTCAGCTCTACTTC -3'
(R):5'- ACTTATGCGGAAGATGCTGG -3'

Sequencing Primer
(F):5'- GTATGACTCAGCTCTACTTCTTTTG -3'
(R):5'- TTATGCGGAAGATGCTGGAGAGG -3'
Posted On2015-07-07