Incidental Mutation 'R4423:Plod2'
ID327211
Institutional Source Beutler Lab
Gene Symbol Plod2
Ensembl Gene ENSMUSG00000032374
Gene Nameprocollagen lysine, 2-oxoglutarate 5-dioxygenase 2
SynonymsD530025C14Rik, Plod-2, LH2, lysyl hydroxylase 2
MMRRC Submission 041143-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4423 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location92542223-92608428 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 92601989 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Serine at position 502 (L502S)
Ref Sequence ENSEMBL: ENSMUSP00000125373 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070522] [ENSMUST00000160359]
Predicted Effect probably benign
Transcript: ENSMUST00000070522
SMART Domains Protein: ENSMUSP00000068611
Gene: ENSMUSG00000032374

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 181 193 N/A INTRINSIC
low complexity region 307 321 N/A INTRINSIC
Blast:P4Hc 453 500 1e-22 BLAST
P4Hc 563 736 6.38e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160359
AA Change: L502S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000125373
Gene: ENSMUSG00000032374
AA Change: L502S

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 181 193 N/A INTRINSIC
low complexity region 307 321 N/A INTRINSIC
Blast:P4Hc 453 500 1e-22 BLAST
P4Hc 584 757 6.38e-21 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161906
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190075
Meta Mutation Damage Score 0.0850 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a membrane-bound homodimeric enzyme that is localized to the cisternae of the rough endoplasmic reticulum. The enzyme (cofactors iron and ascorbate) catalyzes the hydroxylation of lysyl residues in collagen-like peptides. The resultant hydroxylysyl groups are attachment sites for carbohydrates in collagen and thus are critical for the stability of intermolecular crosslinks. Some patients with Ehlers-Danlos syndrome type VIB have deficiencies in lysyl hydroxylase activity. Mutations in the coding region of this gene are associated with Bruck syndrome. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik C A 10: 100,605,633 P100Q probably damaging Het
A630010A05Rik A G 16: 14,618,713 Y210C probably benign Het
Arfgap1 C A 2: 180,981,076 D327E probably benign Het
Arhgef9 T G X: 95,101,064 I131L possibly damaging Het
Asgr2 G A 11: 70,105,385 V218I probably benign Het
Capns2 T A 8: 92,901,624 I47N possibly damaging Het
Cep44 G A 8: 56,538,617 P317S probably benign Het
Cnot10 T A 9: 114,617,920 I363F probably damaging Het
Coch T A 12: 51,598,149 probably null Het
Dnah1 C T 14: 31,284,761 G2199D probably benign Het
Dock9 A G 14: 121,562,053 probably null Het
Dst T C 1: 34,188,393 I1689T possibly damaging Het
Eif2ak4 T C 2: 118,439,066 F762S probably benign Het
Eif2b5 A G 16: 20,501,719 D195G probably benign Het
Elmo1 C G 13: 20,600,212 Y646* probably null Het
Fam183b A T 11: 58,796,531 probably null Het
Far1 T A 7: 113,540,598 S84R probably damaging Het
Fhod1 T C 8: 105,337,351 probably benign Het
Galnt15 A T 14: 32,058,269 I508F possibly damaging Het
Grik1 T C 16: 87,923,200 T745A probably benign Het
Hira A G 16: 18,956,202 D959G possibly damaging Het
Hsf5 T C 11: 87,631,634 L351P probably damaging Het
Icosl C T 10: 78,071,873 T89I possibly damaging Het
Iws1 T A 18: 32,083,450 N414K probably damaging Het
Kif1b A G 4: 149,214,105 S1035P probably damaging Het
Lcp2 G T 11: 34,078,226 probably benign Het
Map4 C T 9: 110,067,594 T631I probably damaging Het
Nepn T A 10: 52,391,815 I59N probably damaging Het
Nin T A 12: 70,042,978 K1221M probably damaging Het
Nup155 A G 15: 8,121,464 T333A probably damaging Het
Olfr651 T C 7: 104,553,345 V142A probably benign Het
Olfr902 A G 9: 38,449,366 T165A probably benign Het
Olfr961 A G 9: 39,647,116 Y130C probably damaging Het
Pnpt1 A G 11: 29,153,375 probably null Het
Ppat A G 5: 76,915,214 W517R probably damaging Het
Ppp1r16b C T 2: 158,757,254 T382I probably benign Het
Prkcq T C 2: 11,256,169 I344T possibly damaging Het
Rbl1 A G 2: 157,168,955 probably benign Het
Rpl31-ps17 C T 12: 54,701,612 noncoding transcript Het
Sec62 T C 3: 30,814,282 M220T unknown Het
Shprh T G 10: 11,186,518 V1219G possibly damaging Het
Slc25a46 T C 18: 31,609,598 T72A probably benign Het
Slc4a2 G A 5: 24,439,848 W1040* probably null Het
Slc5a1 T C 5: 33,154,674 V470A possibly damaging Het
Syvn1 C T 19: 6,049,921 probably benign Het
Tex47 G T 5: 7,305,364 A182S probably benign Het
Thegl T C 5: 77,054,536 I268T possibly damaging Het
Top2a A G 11: 99,001,405 I1077T probably benign Het
Tpcn1 T C 5: 120,542,518 K549R probably damaging Het
Trpm2 T C 10: 77,935,068 D678G probably benign Het
Ube3a T C 7: 59,276,113 I234T probably benign Het
Vmn2r57 T C 7: 41,426,640 K483E probably damaging Het
Wnk1 T A 6: 119,926,426 S2111C probably damaging Het
Zcchc6 T C 13: 59,822,049 K11E probably damaging Het
Other mutations in Plod2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00715:Plod2 APN 9 92598614 missense probably damaging 0.99
IGL00945:Plod2 APN 9 92584496 missense probably benign 0.08
IGL01386:Plod2 APN 9 92606602 missense probably damaging 0.99
IGL01519:Plod2 APN 9 92595295 missense probably benign 0.00
IGL01836:Plod2 APN 9 92606498 splice site probably benign
IGL02490:Plod2 APN 9 92586842 missense probably benign 0.00
IGL02496:Plod2 APN 9 92607094 missense probably damaging 1.00
IGL02699:Plod2 APN 9 92607142 missense probably damaging 1.00
IGL02735:Plod2 APN 9 92595389 splice site probably benign
IGL03106:Plod2 APN 9 92573567 missense probably damaging 0.98
R0270:Plod2 UTSW 9 92584521 missense probably benign 0.10
R0546:Plod2 UTSW 9 92595335 missense probably damaging 1.00
R0589:Plod2 UTSW 9 92593746 missense probably benign
R0707:Plod2 UTSW 9 92605427 missense possibly damaging 0.91
R1491:Plod2 UTSW 9 92606584 missense probably benign 0.00
R1572:Plod2 UTSW 9 92603067 splice site probably benign
R1731:Plod2 UTSW 9 92584604 critical splice donor site probably null
R1895:Plod2 UTSW 9 92607135 missense probably damaging 1.00
R1917:Plod2 UTSW 9 92581257 missense probably benign
R1946:Plod2 UTSW 9 92607135 missense probably damaging 1.00
R3850:Plod2 UTSW 9 92542545 missense probably benign 0.28
R3973:Plod2 UTSW 9 92598619 nonsense probably null
R3974:Plod2 UTSW 9 92598619 nonsense probably null
R4289:Plod2 UTSW 9 92602988 missense possibly damaging 0.89
R4647:Plod2 UTSW 9 92605450 nonsense probably null
R4754:Plod2 UTSW 9 92606531 nonsense probably null
R4769:Plod2 UTSW 9 92595272 missense probably damaging 1.00
R5279:Plod2 UTSW 9 92581323 missense probably damaging 1.00
R5535:Plod2 UTSW 9 92606569 missense probably damaging 1.00
R5654:Plod2 UTSW 9 92593823 missense probably benign
R5764:Plod2 UTSW 9 92603021 missense probably damaging 0.97
R5885:Plod2 UTSW 9 92606656 critical splice donor site probably null
R5940:Plod2 UTSW 9 92591397 missense probably benign 0.39
R6917:Plod2 UTSW 9 92593770 missense possibly damaging 0.87
R7109:Plod2 UTSW 9 92573597 missense probably damaging 1.00
R7221:Plod2 UTSW 9 92584527 missense probably damaging 1.00
R7311:Plod2 UTSW 9 92584558 missense probably damaging 1.00
Z1088:Plod2 UTSW 9 92603035 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTGCTAAGGAATGAGCTTGGATC -3'
(R):5'- CCAATCAGTGCAAAGGAGGC -3'

Sequencing Primer
(F):5'- GTGTCTCACCAAACACGTTAAAGTG -3'
(R):5'- TCAGTGCAAAGGAGGCTATTATG -3'
Posted On2015-07-07