Incidental Mutation 'R4423:Icosl'
ID327217
Institutional Source Beutler Lab
Gene Symbol Icosl
Ensembl Gene ENSMUSG00000000732
Gene Nameicos ligand
SynonymsB7h, B7-H2, B7RP-1, GL50, GL50-B, ICOS-L, LICOS
MMRRC Submission 041143-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.150) question?
Stock #R4423 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location78069302-78083913 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 78071873 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 89 (T89I)
Ref Sequence ENSEMBL: ENSMUSP00000101032 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105393]
Predicted Effect possibly damaging
Transcript: ENSMUST00000105393
AA Change: T89I

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000101032
Gene: ENSMUSG00000000732
AA Change: T89I

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
IG 47 161 4.67e-4 SMART
Pfam:C2-set_2 165 253 5.2e-9 PFAM
transmembrane domain 280 299 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217675
Predicted Effect unknown
Transcript: ENSMUST00000219038
AA Change: T85I
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219633
Meta Mutation Damage Score 0.5274 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 100% (57/57)
MGI Phenotype PHENOTYPE: Mice homozygous for disruptions in this gene exhibit defects in the humoral immune response associated with an impaired interactions between T and B cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik C A 10: 100,605,633 P100Q probably damaging Het
A630010A05Rik A G 16: 14,618,713 Y210C probably benign Het
Arfgap1 C A 2: 180,981,076 D327E probably benign Het
Arhgef9 T G X: 95,101,064 I131L possibly damaging Het
Asgr2 G A 11: 70,105,385 V218I probably benign Het
Capns2 T A 8: 92,901,624 I47N possibly damaging Het
Cep44 G A 8: 56,538,617 P317S probably benign Het
Cnot10 T A 9: 114,617,920 I363F probably damaging Het
Coch T A 12: 51,598,149 probably null Het
Dnah1 C T 14: 31,284,761 G2199D probably benign Het
Dock9 A G 14: 121,562,053 probably null Het
Dst T C 1: 34,188,393 I1689T possibly damaging Het
Eif2ak4 T C 2: 118,439,066 F762S probably benign Het
Eif2b5 A G 16: 20,501,719 D195G probably benign Het
Elmo1 C G 13: 20,600,212 Y646* probably null Het
Fam183b A T 11: 58,796,531 probably null Het
Far1 T A 7: 113,540,598 S84R probably damaging Het
Fhod1 T C 8: 105,337,351 probably benign Het
Galnt15 A T 14: 32,058,269 I508F possibly damaging Het
Grik1 T C 16: 87,923,200 T745A probably benign Het
Hira A G 16: 18,956,202 D959G possibly damaging Het
Hsf5 T C 11: 87,631,634 L351P probably damaging Het
Iws1 T A 18: 32,083,450 N414K probably damaging Het
Kif1b A G 4: 149,214,105 S1035P probably damaging Het
Lcp2 G T 11: 34,078,226 probably benign Het
Map4 C T 9: 110,067,594 T631I probably damaging Het
Nepn T A 10: 52,391,815 I59N probably damaging Het
Nin T A 12: 70,042,978 K1221M probably damaging Het
Nup155 A G 15: 8,121,464 T333A probably damaging Het
Olfr651 T C 7: 104,553,345 V142A probably benign Het
Olfr902 A G 9: 38,449,366 T165A probably benign Het
Olfr961 A G 9: 39,647,116 Y130C probably damaging Het
Plod2 T C 9: 92,601,989 L502S probably benign Het
Pnpt1 A G 11: 29,153,375 probably null Het
Ppat A G 5: 76,915,214 W517R probably damaging Het
Ppp1r16b C T 2: 158,757,254 T382I probably benign Het
Prkcq T C 2: 11,256,169 I344T possibly damaging Het
Rbl1 A G 2: 157,168,955 probably benign Het
Rpl31-ps17 C T 12: 54,701,612 noncoding transcript Het
Sec62 T C 3: 30,814,282 M220T unknown Het
Shprh T G 10: 11,186,518 V1219G possibly damaging Het
Slc25a46 T C 18: 31,609,598 T72A probably benign Het
Slc4a2 G A 5: 24,439,848 W1040* probably null Het
Slc5a1 T C 5: 33,154,674 V470A possibly damaging Het
Syvn1 C T 19: 6,049,921 probably benign Het
Tex47 G T 5: 7,305,364 A182S probably benign Het
Thegl T C 5: 77,054,536 I268T possibly damaging Het
Top2a A G 11: 99,001,405 I1077T probably benign Het
Tpcn1 T C 5: 120,542,518 K549R probably damaging Het
Trpm2 T C 10: 77,935,068 D678G probably benign Het
Ube3a T C 7: 59,276,113 I234T probably benign Het
Vmn2r57 T C 7: 41,426,640 K483E probably damaging Het
Wnk1 T A 6: 119,926,426 S2111C probably damaging Het
Zcchc6 T C 13: 59,822,049 K11E probably damaging Het
Other mutations in Icosl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00980:Icosl APN 10 78071971 missense probably damaging 1.00
IGL02540:Icosl APN 10 78069536 critical splice donor site probably null
R0304:Icosl UTSW 10 78075322 missense probably benign
R0512:Icosl UTSW 10 78071966 missense possibly damaging 0.77
R0584:Icosl UTSW 10 78071875 missense possibly damaging 0.82
R0711:Icosl UTSW 10 78073941 missense probably damaging 1.00
R2005:Icosl UTSW 10 78071953 missense possibly damaging 0.63
R2006:Icosl UTSW 10 78071953 missense possibly damaging 0.63
R2189:Icosl UTSW 10 78073925 missense possibly damaging 0.62
R3417:Icosl UTSW 10 78072035 missense possibly damaging 0.46
R5183:Icosl UTSW 10 78069485 unclassified probably benign
R5579:Icosl UTSW 10 78073763 missense probably damaging 0.99
R6388:Icosl UTSW 10 78069532 missense possibly damaging 0.96
R7336:Icosl UTSW 10 78073873 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCACCTCACACCTGAGTTTG -3'
(R):5'- GGCTGTATTCATAAATACCCGGC -3'

Sequencing Primer
(F):5'- TCACACCTGAGTTTGCTACAAG -3'
(R):5'- GCATGTGAACTCCTGGGTATCC -3'
Posted On2015-07-07