Incidental Mutation 'R4423:Pnpt1'
ID327219
Institutional Source Beutler Lab
Gene Symbol Pnpt1
Ensembl Gene ENSMUSG00000020464
Gene Namepolyribonucleotide nucleotidyltransferase 1
SynonymsPNPase, polynucleotide phosphorylase, 1200003F12Rik
MMRRC Submission 041143-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4423 (G1)
Quality Score190
Status Validated
Chromosome11
Chromosomal Location29130744-29161828 bp(+) (GRCm38)
Type of Mutationsplice site (37 bp from exon)
DNA Base Change (assembly) A to G at 29153375 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000020756 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020756]
PDB Structure Solution structure of the alpha-helical domain from mouse hypothetical PNPase [SOLUTION NMR]
Predicted Effect probably null
Transcript: ENSMUST00000020756
SMART Domains Protein: ENSMUSP00000020756
Gene: ENSMUSG00000020464

DomainStartEndE-ValueType
low complexity region 4 26 N/A INTRINSIC
Pfam:RNase_PH 52 183 1.9e-16 PFAM
Pfam:RNase_PH_C 186 251 3.8e-13 PFAM
Pfam:PNPase 282 363 3.7e-9 PFAM
Pfam:RNase_PH 366 501 3.4e-22 PFAM
Pfam:RNase_PH_C 504 581 7.1e-6 PFAM
KH 604 669 8e-7 SMART
S1 677 750 2.15e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154924
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the evolutionary conserved polynucleotide phosphorylase family comprised of phosphate dependent 3'-to-5' exoribonucleases implicated in RNA processing and degradation. This enzyme is predominantly localized in the mitochondrial intermembrane space and is involved in import of RNA to mitochondria. Mutations in this gene have been associated with combined oxidative phosphorylation deficiency-13 and autosomal recessive nonsyndromic deafness-70. Related pseudogenes are found on chromosomes 3 and 7. [provided by RefSeq, Dec 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality and impaired mitochondrial RNA import. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik C A 10: 100,605,633 P100Q probably damaging Het
A630010A05Rik A G 16: 14,618,713 Y210C probably benign Het
Arfgap1 C A 2: 180,981,076 D327E probably benign Het
Arhgef9 T G X: 95,101,064 I131L possibly damaging Het
Asgr2 G A 11: 70,105,385 V218I probably benign Het
Capns2 T A 8: 92,901,624 I47N possibly damaging Het
Cep44 G A 8: 56,538,617 P317S probably benign Het
Cnot10 T A 9: 114,617,920 I363F probably damaging Het
Coch T A 12: 51,598,149 probably null Het
Dnah1 C T 14: 31,284,761 G2199D probably benign Het
Dock9 A G 14: 121,562,053 probably null Het
Dst T C 1: 34,188,393 I1689T possibly damaging Het
Eif2ak4 T C 2: 118,439,066 F762S probably benign Het
Eif2b5 A G 16: 20,501,719 D195G probably benign Het
Elmo1 C G 13: 20,600,212 Y646* probably null Het
Fam183b A T 11: 58,796,531 probably null Het
Far1 T A 7: 113,540,598 S84R probably damaging Het
Fhod1 T C 8: 105,337,351 probably benign Het
Galnt15 A T 14: 32,058,269 I508F possibly damaging Het
Grik1 T C 16: 87,923,200 T745A probably benign Het
Hira A G 16: 18,956,202 D959G possibly damaging Het
Hsf5 T C 11: 87,631,634 L351P probably damaging Het
Icosl C T 10: 78,071,873 T89I possibly damaging Het
Iws1 T A 18: 32,083,450 N414K probably damaging Het
Kif1b A G 4: 149,214,105 S1035P probably damaging Het
Lcp2 G T 11: 34,078,226 probably benign Het
Map4 C T 9: 110,067,594 T631I probably damaging Het
Nepn T A 10: 52,391,815 I59N probably damaging Het
Nin T A 12: 70,042,978 K1221M probably damaging Het
Nup155 A G 15: 8,121,464 T333A probably damaging Het
Olfr651 T C 7: 104,553,345 V142A probably benign Het
Olfr902 A G 9: 38,449,366 T165A probably benign Het
Olfr961 A G 9: 39,647,116 Y130C probably damaging Het
Plod2 T C 9: 92,601,989 L502S probably benign Het
Ppat A G 5: 76,915,214 W517R probably damaging Het
Ppp1r16b C T 2: 158,757,254 T382I probably benign Het
Prkcq T C 2: 11,256,169 I344T possibly damaging Het
Rbl1 A G 2: 157,168,955 probably benign Het
Rpl31-ps17 C T 12: 54,701,612 noncoding transcript Het
Sec62 T C 3: 30,814,282 M220T unknown Het
Shprh T G 10: 11,186,518 V1219G possibly damaging Het
Slc25a46 T C 18: 31,609,598 T72A probably benign Het
Slc4a2 G A 5: 24,439,848 W1040* probably null Het
Slc5a1 T C 5: 33,154,674 V470A possibly damaging Het
Syvn1 C T 19: 6,049,921 probably benign Het
Tex47 G T 5: 7,305,364 A182S probably benign Het
Thegl T C 5: 77,054,536 I268T possibly damaging Het
Top2a A G 11: 99,001,405 I1077T probably benign Het
Tpcn1 T C 5: 120,542,518 K549R probably damaging Het
Trpm2 T C 10: 77,935,068 D678G probably benign Het
Ube3a T C 7: 59,276,113 I234T probably benign Het
Vmn2r57 T C 7: 41,426,640 K483E probably damaging Het
Wnk1 T A 6: 119,926,426 S2111C probably damaging Het
Zcchc6 T C 13: 59,822,049 K11E probably damaging Het
Other mutations in Pnpt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Pnpt1 APN 11 29154217 critical splice donor site probably null
IGL00920:Pnpt1 APN 11 29157087 splice site probably benign
IGL01358:Pnpt1 APN 11 29138425 missense possibly damaging 0.95
IGL01454:Pnpt1 APN 11 29137142 missense probably benign 0.19
IGL01622:Pnpt1 APN 11 29148272 splice site probably benign
IGL01623:Pnpt1 APN 11 29148272 splice site probably benign
IGL01674:Pnpt1 APN 11 29155787 missense probably benign 0.00
IGL01802:Pnpt1 APN 11 29154306 missense probably damaging 1.00
IGL02222:Pnpt1 APN 11 29159327 missense possibly damaging 0.71
IGL02222:Pnpt1 APN 11 29130842 missense probably benign 0.00
IGL02616:Pnpt1 APN 11 29135505 splice site probably benign
IGL02859:Pnpt1 APN 11 29138162 missense probably damaging 1.00
IGL02965:Pnpt1 APN 11 29156939 missense probably damaging 0.98
IGL03121:Pnpt1 APN 11 29132845 missense probably benign 0.03
PIT4651001:Pnpt1 UTSW 11 29156945 critical splice donor site probably null
R1023:Pnpt1 UTSW 11 29141328 splice site probably benign
R1477:Pnpt1 UTSW 11 29137102 missense probably benign 0.14
R1524:Pnpt1 UTSW 11 29130776 missense unknown
R1769:Pnpt1 UTSW 11 29154159 missense probably benign 0.22
R1839:Pnpt1 UTSW 11 29154342 missense possibly damaging 0.82
R1975:Pnpt1 UTSW 11 29141256 missense probably benign 0.16
R1977:Pnpt1 UTSW 11 29141256 missense probably benign 0.16
R1996:Pnpt1 UTSW 11 29141679 missense probably benign 0.01
R3771:Pnpt1 UTSW 11 29138174 missense probably benign 0.05
R4346:Pnpt1 UTSW 11 29145478 missense probably damaging 1.00
R5354:Pnpt1 UTSW 11 29154166 missense probably damaging 1.00
R5503:Pnpt1 UTSW 11 29138156 missense probably damaging 1.00
R5514:Pnpt1 UTSW 11 29153246 missense possibly damaging 0.82
R5908:Pnpt1 UTSW 11 29130887 missense probably benign 0.00
R6225:Pnpt1 UTSW 11 29145469 missense probably benign 0.38
R6605:Pnpt1 UTSW 11 29138567 missense possibly damaging 0.69
R7096:Pnpt1 UTSW 11 29154867 missense probably benign 0.03
R7214:Pnpt1 UTSW 11 29137285 missense probably damaging 1.00
R7365:Pnpt1 UTSW 11 29161334 missense probably damaging 1.00
R7492:Pnpt1 UTSW 11 29135522 missense probably benign 0.01
R7497:Pnpt1 UTSW 11 29130860 missense probably benign 0.00
R7686:Pnpt1 UTSW 11 29157070 missense probably damaging 0.97
R8166:Pnpt1 UTSW 11 29156875 missense probably benign
R8309:Pnpt1 UTSW 11 29153277 missense probably benign 0.01
R8389:Pnpt1 UTSW 11 29130758 start codon destroyed unknown
R8542:Pnpt1 UTSW 11 29132773 splice site probably null
R8737:Pnpt1 UTSW 11 29154815 critical splice acceptor site probably null
Z1176:Pnpt1 UTSW 11 29145475 missense probably benign 0.00
Z1176:Pnpt1 UTSW 11 29145477 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- CAACAGAATTCAGACTGTCTTATGC -3'
(R):5'- ACTGCTCTGCATTCTTGAAATGAAC -3'

Sequencing Primer
(F):5'- TCAGACTGTCTTATGCTACTACATAC -3'
(R):5'- TATAGTGTGGTGATCCCCAACCAG -3'
Posted On2015-07-07