Incidental Mutation 'R4423:Eif2b5'
ID327235
Institutional Source Beutler Lab
Gene Symbol Eif2b5
Ensembl Gene ENSMUSG00000003235
Gene Nameeukaryotic translation initiation factor 2B, subunit 5 epsilon
Synonyms
MMRRC Submission 041143-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.963) question?
Stock #R4423 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location20498817-20509323 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 20501719 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 195 (D195G)
Ref Sequence ENSEMBL: ENSMUSP00000003320 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003320] [ENSMUST00000148714]
Predicted Effect probably benign
Transcript: ENSMUST00000003320
AA Change: D195G

PolyPhen 2 Score 0.100 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000003320
Gene: ENSMUSG00000003235
AA Change: D195G

DomainStartEndE-ValueType
low complexity region 2 31 N/A INTRINSIC
Pfam:Hexapep 341 372 9.8e-5 PFAM
Pfam:Hexapep 361 389 6.1e-6 PFAM
low complexity region 517 526 N/A INTRINSIC
eIF5C 625 712 8.43e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000148714
SMART Domains Protein: ENSMUSP00000121169
Gene: ENSMUSG00000003235

DomainStartEndE-ValueType
Pfam:W2 82 150 7e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000231315
Meta Mutation Damage Score 0.1489 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of five subunits of eukaryotic translation initiation factor 2B (EIF2B), a GTP exchange factor for eukaryotic initiation factor 2 and an essential regulator for protein synthesis. Mutations in this gene and the genes encoding other EIF2B subunits have been associated with leukoencephalopathy with vanishing white matter. [provided by RefSeq, Nov 2009]
PHENOTYPE: Mice homozygous for a knock-in allele exhibit abnormal brain white matter development, decreased body fat, demyelination, impaired recovery from cuprizone-induced demyelination, and impaired coordination. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik C A 10: 100,605,633 P100Q probably damaging Het
A630010A05Rik A G 16: 14,618,713 Y210C probably benign Het
Arfgap1 C A 2: 180,981,076 D327E probably benign Het
Arhgef9 T G X: 95,101,064 I131L possibly damaging Het
Asgr2 G A 11: 70,105,385 V218I probably benign Het
Capns2 T A 8: 92,901,624 I47N possibly damaging Het
Cep44 G A 8: 56,538,617 P317S probably benign Het
Cnot10 T A 9: 114,617,920 I363F probably damaging Het
Coch T A 12: 51,598,149 probably null Het
Dnah1 C T 14: 31,284,761 G2199D probably benign Het
Dock9 A G 14: 121,562,053 probably null Het
Dst T C 1: 34,188,393 I1689T possibly damaging Het
Eif2ak4 T C 2: 118,439,066 F762S probably benign Het
Elmo1 C G 13: 20,600,212 Y646* probably null Het
Fam183b A T 11: 58,796,531 probably null Het
Far1 T A 7: 113,540,598 S84R probably damaging Het
Fhod1 T C 8: 105,337,351 probably benign Het
Galnt15 A T 14: 32,058,269 I508F possibly damaging Het
Grik1 T C 16: 87,923,200 T745A probably benign Het
Hira A G 16: 18,956,202 D959G possibly damaging Het
Hsf5 T C 11: 87,631,634 L351P probably damaging Het
Icosl C T 10: 78,071,873 T89I possibly damaging Het
Iws1 T A 18: 32,083,450 N414K probably damaging Het
Kif1b A G 4: 149,214,105 S1035P probably damaging Het
Lcp2 G T 11: 34,078,226 probably benign Het
Map4 C T 9: 110,067,594 T631I probably damaging Het
Nepn T A 10: 52,391,815 I59N probably damaging Het
Nin T A 12: 70,042,978 K1221M probably damaging Het
Nup155 A G 15: 8,121,464 T333A probably damaging Het
Olfr651 T C 7: 104,553,345 V142A probably benign Het
Olfr902 A G 9: 38,449,366 T165A probably benign Het
Olfr961 A G 9: 39,647,116 Y130C probably damaging Het
Plod2 T C 9: 92,601,989 L502S probably benign Het
Pnpt1 A G 11: 29,153,375 probably null Het
Ppat A G 5: 76,915,214 W517R probably damaging Het
Ppp1r16b C T 2: 158,757,254 T382I probably benign Het
Prkcq T C 2: 11,256,169 I344T possibly damaging Het
Rbl1 A G 2: 157,168,955 probably benign Het
Rpl31-ps17 C T 12: 54,701,612 noncoding transcript Het
Sec62 T C 3: 30,814,282 M220T unknown Het
Shprh T G 10: 11,186,518 V1219G possibly damaging Het
Slc25a46 T C 18: 31,609,598 T72A probably benign Het
Slc4a2 G A 5: 24,439,848 W1040* probably null Het
Slc5a1 T C 5: 33,154,674 V470A possibly damaging Het
Syvn1 C T 19: 6,049,921 probably benign Het
Tex47 G T 5: 7,305,364 A182S probably benign Het
Thegl T C 5: 77,054,536 I268T possibly damaging Het
Top2a A G 11: 99,001,405 I1077T probably benign Het
Tpcn1 T C 5: 120,542,518 K549R probably damaging Het
Trpm2 T C 10: 77,935,068 D678G probably benign Het
Ube3a T C 7: 59,276,113 I234T probably benign Het
Vmn2r57 T C 7: 41,426,640 K483E probably damaging Het
Wnk1 T A 6: 119,926,426 S2111C probably damaging Het
Zcchc6 T C 13: 59,822,049 K11E probably damaging Het
Other mutations in Eif2b5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00946:Eif2b5 APN 16 20505252 missense probably benign 0.19
IGL01073:Eif2b5 APN 16 20500296 nonsense probably null
IGL01467:Eif2b5 APN 16 20508964 nonsense probably null
IGL02754:Eif2b5 APN 16 20502786 missense possibly damaging 0.50
IGL03286:Eif2b5 APN 16 20502262 missense probably damaging 1.00
R0569:Eif2b5 UTSW 16 20502553 missense probably benign 0.13
R1321:Eif2b5 UTSW 16 20504689 nonsense probably null
R1647:Eif2b5 UTSW 16 20502585 missense possibly damaging 0.77
R1648:Eif2b5 UTSW 16 20502585 missense possibly damaging 0.77
R1897:Eif2b5 UTSW 16 20507037 missense probably damaging 0.99
R2231:Eif2b5 UTSW 16 20504770 missense probably benign
R3196:Eif2b5 UTSW 16 20505522 missense probably benign
R4776:Eif2b5 UTSW 16 20500233 missense probably damaging 1.00
R5240:Eif2b5 UTSW 16 20501398 missense possibly damaging 0.49
R5828:Eif2b5 UTSW 16 20502786 missense possibly damaging 0.50
R5920:Eif2b5 UTSW 16 20498944 missense unknown
R5925:Eif2b5 UTSW 16 20508124 missense probably benign 0.02
R6717:Eif2b5 UTSW 16 20505283 missense probably damaging 0.96
R6915:Eif2b5 UTSW 16 20502750 missense possibly damaging 0.83
R7396:Eif2b5 UTSW 16 20506137 missense possibly damaging 0.69
R8046:Eif2b5 UTSW 16 20506404 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- CAATATCTGCAGAGCCCTGG -3'
(R):5'- AATCATATCGAATCTCCACTCCGTC -3'

Sequencing Primer
(F):5'- CAGAGCCCTGGAGGAACAC -3'
(R):5'- GTCTCCACTGCCCTGGAAC -3'
Posted On2015-07-07