Incidental Mutation 'R4423:Syvn1'
ID327239
Institutional Source Beutler Lab
Gene Symbol Syvn1
Ensembl Gene ENSMUSG00000024807
Gene Namesynovial apoptosis inhibitor 1, synoviolin
Synonyms1200010C09Rik, Hrd1
MMRRC Submission 041143-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4423 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location6046576-6053712 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) C to T at 6049921 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000121885 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007482] [ENSMUST00000025723] [ENSMUST00000129081] [ENSMUST00000134667] [ENSMUST00000138532] [ENSMUST00000156550]
Predicted Effect probably benign
Transcript: ENSMUST00000007482
SMART Domains Protein: ENSMUSP00000007482
Gene: ENSMUSG00000007338

DomainStartEndE-ValueType
Pfam:Img2 82 166 5.1e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000025723
SMART Domains Protein: ENSMUSP00000025723
Gene: ENSMUSG00000024807

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
transmembrane domain 45 67 N/A INTRINSIC
transmembrane domain 103 120 N/A INTRINSIC
transmembrane domain 124 146 N/A INTRINSIC
transmembrane domain 159 181 N/A INTRINSIC
RING 240 278 4.7e-10 SMART
low complexity region 286 357 N/A INTRINSIC
low complexity region 365 426 N/A INTRINSIC
low complexity region 488 528 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129081
SMART Domains Protein: ENSMUSP00000118698
Gene: ENSMUSG00000024807

DomainStartEndE-ValueType
transmembrane domain 5 25 N/A INTRINSIC
transmembrane domain 45 67 N/A INTRINSIC
transmembrane domain 103 120 N/A INTRINSIC
transmembrane domain 135 157 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000134667
SMART Domains Protein: ENSMUSP00000114960
Gene: ENSMUSG00000024807

DomainStartEndE-ValueType
transmembrane domain 5 24 N/A INTRINSIC
transmembrane domain 45 67 N/A INTRINSIC
transmembrane domain 103 120 N/A INTRINSIC
transmembrane domain 133 155 N/A INTRINSIC
transmembrane domain 170 192 N/A INTRINSIC
transmembrane domain 213 235 N/A INTRINSIC
RING 291 329 9.74e-8 SMART
low complexity region 337 408 N/A INTRINSIC
low complexity region 416 477 N/A INTRINSIC
low complexity region 539 579 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000138532
SMART Domains Protein: ENSMUSP00000114843
Gene: ENSMUSG00000024807

DomainStartEndE-ValueType
transmembrane domain 5 24 N/A INTRINSIC
transmembrane domain 45 67 N/A INTRINSIC
transmembrane domain 103 120 N/A INTRINSIC
transmembrane domain 133 155 N/A INTRINSIC
transmembrane domain 170 192 N/A INTRINSIC
transmembrane domain 213 235 N/A INTRINSIC
RING 291 329 9.74e-8 SMART
low complexity region 337 408 N/A INTRINSIC
low complexity region 416 477 N/A INTRINSIC
low complexity region 539 579 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142101
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144328
Predicted Effect probably benign
Transcript: ENSMUST00000156550
SMART Domains Protein: ENSMUSP00000121885
Gene: ENSMUSG00000024807

DomainStartEndE-ValueType
transmembrane domain 5 24 N/A INTRINSIC
transmembrane domain 45 67 N/A INTRINSIC
transmembrane domain 103 120 N/A INTRINSIC
transmembrane domain 133 155 N/A INTRINSIC
transmembrane domain 170 192 N/A INTRINSIC
transmembrane domain 213 235 N/A INTRINSIC
RING 291 329 9.74e-8 SMART
low complexity region 337 408 N/A INTRINSIC
low complexity region 416 477 N/A INTRINSIC
low complexity region 539 573 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184338
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein involved in endoplasmic reticulum (ER)-associated degradation. The encoded protein removes unfolded proteins, accumulated during ER stress, by retrograde transport to the cytosol from the ER. This protein also uses the ubiquitin-proteasome system for additional degradation of unfolded proteins. Sequence analysis identified two transcript variants that encode different isoforms. [provided by RefSeq, May 2011]
PHENOTYPE: Haploinsufficiency results in embryonic death due to systemic abnormal apoptosis. Mice are viable when only a single copy is inactivated and they exhibit a resistance to collagen-induced arthritis due to enhanced apoptosis of synovial cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik C A 10: 100,605,633 P100Q probably damaging Het
A630010A05Rik A G 16: 14,618,713 Y210C probably benign Het
Arfgap1 C A 2: 180,981,076 D327E probably benign Het
Arhgef9 T G X: 95,101,064 I131L possibly damaging Het
Asgr2 G A 11: 70,105,385 V218I probably benign Het
Capns2 T A 8: 92,901,624 I47N possibly damaging Het
Cep44 G A 8: 56,538,617 P317S probably benign Het
Cnot10 T A 9: 114,617,920 I363F probably damaging Het
Coch T A 12: 51,598,149 probably null Het
Dnah1 C T 14: 31,284,761 G2199D probably benign Het
Dock9 A G 14: 121,562,053 probably null Het
Dst T C 1: 34,188,393 I1689T possibly damaging Het
Eif2ak4 T C 2: 118,439,066 F762S probably benign Het
Eif2b5 A G 16: 20,501,719 D195G probably benign Het
Elmo1 C G 13: 20,600,212 Y646* probably null Het
Fam183b A T 11: 58,796,531 probably null Het
Far1 T A 7: 113,540,598 S84R probably damaging Het
Fhod1 T C 8: 105,337,351 probably benign Het
Galnt15 A T 14: 32,058,269 I508F possibly damaging Het
Grik1 T C 16: 87,923,200 T745A probably benign Het
Hira A G 16: 18,956,202 D959G possibly damaging Het
Hsf5 T C 11: 87,631,634 L351P probably damaging Het
Icosl C T 10: 78,071,873 T89I possibly damaging Het
Iws1 T A 18: 32,083,450 N414K probably damaging Het
Kif1b A G 4: 149,214,105 S1035P probably damaging Het
Lcp2 G T 11: 34,078,226 probably benign Het
Map4 C T 9: 110,067,594 T631I probably damaging Het
Nepn T A 10: 52,391,815 I59N probably damaging Het
Nin T A 12: 70,042,978 K1221M probably damaging Het
Nup155 A G 15: 8,121,464 T333A probably damaging Het
Olfr651 T C 7: 104,553,345 V142A probably benign Het
Olfr902 A G 9: 38,449,366 T165A probably benign Het
Olfr961 A G 9: 39,647,116 Y130C probably damaging Het
Plod2 T C 9: 92,601,989 L502S probably benign Het
Pnpt1 A G 11: 29,153,375 probably null Het
Ppat A G 5: 76,915,214 W517R probably damaging Het
Ppp1r16b C T 2: 158,757,254 T382I probably benign Het
Prkcq T C 2: 11,256,169 I344T possibly damaging Het
Rbl1 A G 2: 157,168,955 probably benign Het
Rpl31-ps17 C T 12: 54,701,612 noncoding transcript Het
Sec62 T C 3: 30,814,282 M220T unknown Het
Shprh T G 10: 11,186,518 V1219G possibly damaging Het
Slc25a46 T C 18: 31,609,598 T72A probably benign Het
Slc4a2 G A 5: 24,439,848 W1040* probably null Het
Slc5a1 T C 5: 33,154,674 V470A possibly damaging Het
Tex47 G T 5: 7,305,364 A182S probably benign Het
Thegl T C 5: 77,054,536 I268T possibly damaging Het
Top2a A G 11: 99,001,405 I1077T probably benign Het
Tpcn1 T C 5: 120,542,518 K549R probably damaging Het
Trpm2 T C 10: 77,935,068 D678G probably benign Het
Ube3a T C 7: 59,276,113 I234T probably benign Het
Vmn2r57 T C 7: 41,426,640 K483E probably damaging Het
Wnk1 T A 6: 119,926,426 S2111C probably damaging Het
Zcchc6 T C 13: 59,822,049 K11E probably damaging Het
Other mutations in Syvn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01988:Syvn1 APN 19 6052407 missense probably benign 0.00
IGL02004:Syvn1 APN 19 6052407 missense probably benign 0.00
IGL02218:Syvn1 APN 19 6050199 missense probably damaging 1.00
IGL02335:Syvn1 APN 19 6050093 critical splice donor site probably null
IGL02385:Syvn1 APN 19 6048540 missense probably damaging 1.00
IGL02700:Syvn1 APN 19 6047943 missense probably benign 0.03
IGL02904:Syvn1 APN 19 6049815 nonsense probably null
R0833:Syvn1 UTSW 19 6052453 missense probably benign 0.04
R1886:Syvn1 UTSW 19 6049227 missense possibly damaging 0.84
R2031:Syvn1 UTSW 19 6050530 missense probably damaging 1.00
R4299:Syvn1 UTSW 19 6049921 intron probably benign
R4347:Syvn1 UTSW 19 6049921 intron probably benign
R4422:Syvn1 UTSW 19 6049921 intron probably benign
R4424:Syvn1 UTSW 19 6049921 intron probably benign
R4425:Syvn1 UTSW 19 6049921 intron probably benign
R4647:Syvn1 UTSW 19 6051474 missense probably benign 0.13
R5960:Syvn1 UTSW 19 6050568 missense probably damaging 1.00
R6388:Syvn1 UTSW 19 6052351 missense probably damaging 0.97
R6940:Syvn1 UTSW 19 6051184 unclassified probably benign
R7728:Syvn1 UTSW 19 6051205 missense unknown
Predicted Primers PCR Primer
(F):5'- GCACCTCTGTCTTGAAGCCTAG -3'
(R):5'- ACCTCATGGCCAGGTACATG -3'

Sequencing Primer
(F):5'- GGGAAGCTGGTACTCACATCCATC -3'
(R):5'- CCAGGTACATGGGCCTAATG -3'
Posted On2015-07-07