Incidental Mutation 'R4424:Chrnd'
ID327241
Institutional Source Beutler Lab
Gene Symbol Chrnd
Ensembl Gene ENSMUSG00000026251
Gene Namecholinergic receptor, nicotinic, delta polypeptide
SynonymsAcrd, Achr-4
MMRRC Submission 041696-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.149) question?
Stock #R4424 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location87190607-87200070 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 87195790 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 350 (V350A)
Ref Sequence ENSEMBL: ENSMUSP00000072983 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073252] [ENSMUST00000186373]
Predicted Effect probably benign
Transcript: ENSMUST00000073252
AA Change: V350A

PolyPhen 2 Score 0.378 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000072983
Gene: ENSMUSG00000026251
AA Change: V350A

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
Pfam:Neur_chan_LBD 28 249 4.4e-70 PFAM
Pfam:Neur_chan_memb 256 492 1.1e-74 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000186373
AA Change: V241A

PolyPhen 2 Score 0.101 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000139537
Gene: ENSMUSG00000026251
AA Change: V241A

DomainStartEndE-ValueType
Pfam:Neur_chan_LBD 1 140 4.2e-40 PFAM
Pfam:Neur_chan_memb 147 383 6.6e-63 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189970
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 95% (69/73)
MGI Phenotype FUNCTION: This gene encodes the delta subunit of the muscle-derived nicotinic acetylcholine receptor, a pentameric neurotransmitter receptor and member of the ligand-gated ion channel superfamily. The delta subunit together with the alpha subunit forms the ligand-binding site. [provided by RefSeq, Nov 2012]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933409G03Rik A T 2: 68,615,147 probably benign Het
Aimp1 A T 3: 132,667,492 L229Q probably benign Het
Ankrd16 T A 2: 11,784,404 D267E possibly damaging Het
Apol11b A G 15: 77,637,933 probably null Het
Arfgap1 C A 2: 180,981,076 D327E probably benign Het
Arid3b A T 9: 57,833,868 D98E probably benign Het
Art2b T A 7: 101,579,922 I257F probably benign Het
Atp5a1 T A 18: 77,780,066 probably benign Het
Carmil3 A G 14: 55,501,471 T861A probably benign Het
Cep164 A T 9: 45,779,704 F1259L possibly damaging Het
Clcn7 T C 17: 25,160,176 L744P probably damaging Het
Csl T A 10: 99,758,591 D204V possibly damaging Het
Cyp2c29 G T 19: 39,287,176 W20L probably damaging Het
Dhrs13 G T 11: 78,037,125 G266* probably null Het
Dll3 T C 7: 28,296,291 N362D probably damaging Het
Fanca A G 8: 123,288,793 V715A probably benign Het
Fhod1 T C 8: 105,337,351 probably benign Het
Fpr2 C T 17: 17,893,132 P130L probably damaging Het
Glce A G 9: 62,060,253 Y539H probably damaging Het
Gm11639 T G 11: 104,736,114 probably null Het
Gm4758 A G 16: 36,312,589 D76G probably null Het
Hfe A T 13: 23,706,883 V91E probably benign Het
Hoxd13 A T 2: 74,669,957 K281* probably null Het
Ighv1-66 A T 12: 115,593,537 W3R probably damaging Het
Impg2 G A 16: 56,260,025 V622I possibly damaging Het
Jun A G 4: 95,050,847 M142T probably benign Het
Krt78 T C 15: 101,947,940 T479A probably benign Het
Lama3 T A 18: 12,519,872 C216* probably null Het
Lin54 G T 5: 100,446,560 T582K probably damaging Het
Maats1 G T 16: 38,320,365 P409T probably damaging Het
Mapk11 A G 15: 89,145,373 probably null Het
Mindy3 A G 2: 12,348,199 M397T probably benign Het
Mrpl41 T C 2: 24,974,406 T85A possibly damaging Het
Msh6 T A 17: 87,990,789 L1354* probably null Het
Mtmr12 T C 15: 12,230,314 V41A probably damaging Het
Myh2 A T 11: 67,192,725 Q1478L probably benign Het
Myo6 A G 9: 80,288,038 K897E probably benign Het
Naprt G T 15: 75,892,756 probably null Het
Nrl G A 14: 55,522,218 S84L probably benign Het
Nxf1 A G 19: 8,766,764 probably benign Het
Olfr971 A T 9: 39,840,356 R307S possibly damaging Het
Panx2 G T 15: 89,068,220 V305F probably benign Het
Pcdhga1 T C 18: 37,662,579 L212P probably damaging Het
Pik3ap1 G A 19: 41,375,881 T133I probably benign Het
Ppat A G 5: 76,915,214 W517R probably damaging Het
Ppp1r16b C T 2: 158,757,254 T382I probably benign Het
Prkdc A G 16: 15,773,739 K2694E probably damaging Het
Prkdc G A 16: 15,836,082 R3901H probably damaging Het
Psma8 A G 18: 14,721,190 I42M probably damaging Het
Ptprd A T 4: 76,102,963 M599K probably benign Het
Rnmt A G 18: 68,311,671 D237G probably null Het
Rpl31-ps17 C T 12: 54,701,612 noncoding transcript Het
Scaf11 G A 15: 96,418,428 T1085I possibly damaging Het
Sec14l3 G A 11: 4,066,210 R43Q probably damaging Het
Shc4 G T 2: 125,652,522 T131K probably benign Het
Snx27 A G 3: 94,562,023 F4L probably benign Het
Sorcs1 T C 19: 50,378,941 T228A probably damaging Het
Sptan1 C T 2: 30,029,709 probably benign Het
Syvn1 C T 19: 6,049,921 probably benign Het
Tex47 G T 5: 7,305,364 A182S probably benign Het
Thegl T C 5: 77,054,536 I268T possibly damaging Het
Tpcn1 T C 5: 120,542,518 K549R probably damaging Het
Upf3a C A 8: 13,796,573 P318T probably benign Het
Zbtb40 A T 4: 136,998,694 M518K probably damaging Het
Zcchc14 G A 8: 121,651,941 probably benign Het
Zfp687 G A 3: 95,009,128 P861L probably damaging Het
Other mutations in Chrnd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00743:Chrnd APN 1 87192927 nonsense probably null
IGL00754:Chrnd APN 1 87195784 missense probably benign 0.00
IGL00765:Chrnd APN 1 87195709 missense probably damaging 1.00
IGL01666:Chrnd APN 1 87198736 missense possibly damaging 0.55
IGL03179:Chrnd APN 1 87195780 missense probably damaging 1.00
R0071:Chrnd UTSW 1 87192837 splice site probably benign
R0071:Chrnd UTSW 1 87192837 splice site probably benign
R0531:Chrnd UTSW 1 87194819 missense probably damaging 1.00
R1164:Chrnd UTSW 1 87192545 missense probably benign
R1386:Chrnd UTSW 1 87192590 missense probably damaging 0.97
R1768:Chrnd UTSW 1 87194928 missense probably benign
R1780:Chrnd UTSW 1 87192548 missense possibly damaging 0.52
R2336:Chrnd UTSW 1 87194893 missense probably damaging 1.00
R4093:Chrnd UTSW 1 87191007 nonsense probably null
R4467:Chrnd UTSW 1 87197377 missense probably damaging 0.99
R4828:Chrnd UTSW 1 87191571 splice site probably benign
R5701:Chrnd UTSW 1 87197658 missense possibly damaging 0.77
R5895:Chrnd UTSW 1 87195667 splice site probably null
R6159:Chrnd UTSW 1 87191090 missense probably benign
R6321:Chrnd UTSW 1 87192229 missense probably damaging 1.00
R6927:Chrnd UTSW 1 87198712 missense probably damaging 1.00
R7189:Chrnd UTSW 1 87191058 missense probably damaging 1.00
R7242:Chrnd UTSW 1 87197479 missense probably damaging 0.99
R7420:Chrnd UTSW 1 87194821 missense possibly damaging 0.89
R7996:Chrnd UTSW 1 87191106 missense probably damaging 1.00
R8501:Chrnd UTSW 1 87192616 missense probably damaging 1.00
R8944:Chrnd UTSW 1 87192275 missense probably damaging 1.00
R8963:Chrnd UTSW 1 87194881 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTATATACAGCCCTGCCCACAG -3'
(R):5'- GTCTTGTCCCAAACACCCTG -3'

Sequencing Primer
(F):5'- AGCCAGCCTTGCCCATG -3'
(R):5'- TCAAGCTTGGTGGAAAATGCTCC -3'
Posted On2015-07-07