Incidental Mutation 'R4424:Mrpl41'
ID327244
Institutional Source Beutler Lab
Gene Symbol Mrpl41
Ensembl Gene ENSMUSG00000036850
Gene Namemitochondrial ribosomal protein L41
SynonymsRpml27, MRP-L27
MMRRC Submission 041696-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4424 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location24974117-24975098 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 24974406 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 85 (T85A)
Ref Sequence ENSEMBL: ENSMUSP00000043561 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028351] [ENSMUST00000045295] [ENSMUST00000045604] [ENSMUST00000124383] [ENSMUST00000126909] [ENSMUST00000137913] [ENSMUST00000152777] [ENSMUST00000153618] [ENSMUST00000194392]
Predicted Effect probably benign
Transcript: ENSMUST00000028351
SMART Domains Protein: ENSMUSP00000028351
Gene: ENSMUSG00000026975

DomainStartEndE-ValueType
Blast:WD40 74 118 3e-10 BLAST
Blast:WD40 128 175 3e-15 BLAST
WD40 183 223 7.43e-1 SMART
WD40 227 267 1.08e-4 SMART
WD40 271 310 1.37e2 SMART
WD40 420 455 1.97e2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000045295
SMART Domains Protein: ENSMUSP00000044078
Gene: ENSMUSG00000036833

DomainStartEndE-ValueType
transmembrane domain 36 58 N/A INTRINSIC
low complexity region 59 66 N/A INTRINSIC
cNMP 170 295 2.06e-12 SMART
low complexity region 439 444 N/A INTRINSIC
cNMP 481 600 1.16e-6 SMART
cNMP 603 716 1.55e-7 SMART
Pfam:Patatin 950 1116 3.2e-24 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000045604
AA Change: T85A

PolyPhen 2 Score 0.910 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000043561
Gene: ENSMUSG00000036850
AA Change: T85A

DomainStartEndE-ValueType
Pfam:MRP-L27 13 125 1.3e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124383
Predicted Effect probably benign
Transcript: ENSMUST00000126909
Predicted Effect probably benign
Transcript: ENSMUST00000137913
SMART Domains Protein: ENSMUSP00000141577
Gene: ENSMUSG00000036833

DomainStartEndE-ValueType
transmembrane domain 10 32 N/A INTRINSIC
low complexity region 33 40 N/A INTRINSIC
Pfam:cNMP_binding 162 200 2.7e-5 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139031
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139643
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146382
Predicted Effect probably benign
Transcript: ENSMUST00000152777
SMART Domains Protein: ENSMUSP00000122394
Gene: ENSMUSG00000036833

DomainStartEndE-ValueType
cNMP 89 179 4.98e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000153618
SMART Domains Protein: ENSMUSP00000117428
Gene: ENSMUSG00000036833

DomainStartEndE-ValueType
transmembrane domain 34 56 N/A INTRINSIC
low complexity region 57 64 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194392
SMART Domains Protein: ENSMUSP00000141974
Gene: ENSMUSG00000036850

DomainStartEndE-ValueType
Pfam:MRP-L27 56 98 1.1e-12 PFAM
Meta Mutation Damage Score 0.3959 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 95% (69/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 39S subunit protein that belongs to the YmL27 ribosomal protein family. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit flattened pancake appearance at E9. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933409G03Rik A T 2: 68,615,147 probably benign Het
Aimp1 A T 3: 132,667,492 L229Q probably benign Het
Ankrd16 T A 2: 11,784,404 D267E possibly damaging Het
Apol11b A G 15: 77,637,933 probably null Het
Arfgap1 C A 2: 180,981,076 D327E probably benign Het
Arid3b A T 9: 57,833,868 D98E probably benign Het
Art2b T A 7: 101,579,922 I257F probably benign Het
Atp5a1 T A 18: 77,780,066 probably benign Het
Carmil3 A G 14: 55,501,471 T861A probably benign Het
Cep164 A T 9: 45,779,704 F1259L possibly damaging Het
Chrnd T C 1: 87,195,790 V350A probably benign Het
Clcn7 T C 17: 25,160,176 L744P probably damaging Het
Csl T A 10: 99,758,591 D204V possibly damaging Het
Cyp2c29 G T 19: 39,287,176 W20L probably damaging Het
Dhrs13 G T 11: 78,037,125 G266* probably null Het
Dll3 T C 7: 28,296,291 N362D probably damaging Het
Fanca A G 8: 123,288,793 V715A probably benign Het
Fhod1 T C 8: 105,337,351 probably benign Het
Fpr2 C T 17: 17,893,132 P130L probably damaging Het
Glce A G 9: 62,060,253 Y539H probably damaging Het
Gm11639 T G 11: 104,736,114 probably null Het
Gm4758 A G 16: 36,312,589 D76G probably null Het
Hfe A T 13: 23,706,883 V91E probably benign Het
Hoxd13 A T 2: 74,669,957 K281* probably null Het
Ighv1-66 A T 12: 115,593,537 W3R probably damaging Het
Impg2 G A 16: 56,260,025 V622I possibly damaging Het
Jun A G 4: 95,050,847 M142T probably benign Het
Krt78 T C 15: 101,947,940 T479A probably benign Het
Lama3 T A 18: 12,519,872 C216* probably null Het
Lin54 G T 5: 100,446,560 T582K probably damaging Het
Maats1 G T 16: 38,320,365 P409T probably damaging Het
Mapk11 A G 15: 89,145,373 probably null Het
Mindy3 A G 2: 12,348,199 M397T probably benign Het
Msh6 T A 17: 87,990,789 L1354* probably null Het
Mtmr12 T C 15: 12,230,314 V41A probably damaging Het
Myh2 A T 11: 67,192,725 Q1478L probably benign Het
Myo6 A G 9: 80,288,038 K897E probably benign Het
Naprt G T 15: 75,892,756 probably null Het
Nrl G A 14: 55,522,218 S84L probably benign Het
Nxf1 A G 19: 8,766,764 probably benign Het
Olfr971 A T 9: 39,840,356 R307S possibly damaging Het
Panx2 G T 15: 89,068,220 V305F probably benign Het
Pcdhga1 T C 18: 37,662,579 L212P probably damaging Het
Pik3ap1 G A 19: 41,375,881 T133I probably benign Het
Ppat A G 5: 76,915,214 W517R probably damaging Het
Ppp1r16b C T 2: 158,757,254 T382I probably benign Het
Prkdc A G 16: 15,773,739 K2694E probably damaging Het
Prkdc G A 16: 15,836,082 R3901H probably damaging Het
Psma8 A G 18: 14,721,190 I42M probably damaging Het
Ptprd A T 4: 76,102,963 M599K probably benign Het
Rnmt A G 18: 68,311,671 D237G probably null Het
Rpl31-ps17 C T 12: 54,701,612 noncoding transcript Het
Scaf11 G A 15: 96,418,428 T1085I possibly damaging Het
Sec14l3 G A 11: 4,066,210 R43Q probably damaging Het
Shc4 G T 2: 125,652,522 T131K probably benign Het
Snx27 A G 3: 94,562,023 F4L probably benign Het
Sorcs1 T C 19: 50,378,941 T228A probably damaging Het
Sptan1 C T 2: 30,029,709 probably benign Het
Syvn1 C T 19: 6,049,921 probably benign Het
Tex47 G T 5: 7,305,364 A182S probably benign Het
Thegl T C 5: 77,054,536 I268T possibly damaging Het
Tpcn1 T C 5: 120,542,518 K549R probably damaging Het
Upf3a C A 8: 13,796,573 P318T probably benign Het
Zbtb40 A T 4: 136,998,694 M518K probably damaging Het
Zcchc14 G A 8: 121,651,941 probably benign Het
Zfp687 G A 3: 95,009,128 P861L probably damaging Het
Other mutations in Mrpl41
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01333:Mrpl41 APN 2 24974441 missense probably benign 0.00
IGL01710:Mrpl41 APN 2 24974417 missense possibly damaging 0.62
IGL02019:Mrpl41 APN 2 24974417 missense possibly damaging 0.62
IGL02037:Mrpl41 APN 2 24974417 missense possibly damaging 0.62
R1727:Mrpl41 UTSW 2 24974624 missense probably damaging 1.00
R5060:Mrpl41 UTSW 2 24974283 missense probably damaging 1.00
R7141:Mrpl41 UTSW 2 24974456 missense probably damaging 1.00
R8807:Mrpl41 UTSW 2 24974866 missense unknown
Predicted Primers PCR Primer
(F):5'- GAAGCTGCCCCTACTCTTTGAG -3'
(R):5'- CTTCACTAAGAGTCGGGGTG -3'

Sequencing Primer
(F):5'- TGCCCCTACTCTTTGAGACAATAAG -3'
(R):5'- CACTAAGAGTCGGGGTGCCAAG -3'
Posted On2015-07-07