Incidental Mutation 'R4424:Zfp687'
ID327252
Institutional Source Beutler Lab
Gene Symbol Zfp687
Ensembl Gene ENSMUSG00000019338
Gene Namezinc finger protein 687
Synonyms4931408L03Rik
MMRRC Submission 041696-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.486) question?
Stock #R4424 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location95006590-95015448 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 95009128 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 861 (P861L)
Ref Sequence ENSEMBL: ENSMUSP00000019482 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019482] [ENSMUST00000072287] [ENSMUST00000107251] [ENSMUST00000125476] [ENSMUST00000128438] [ENSMUST00000132195] [ENSMUST00000133297] [ENSMUST00000137799] [ENSMUST00000149747] [ENSMUST00000167008]
Predicted Effect probably damaging
Transcript: ENSMUST00000019482
AA Change: P861L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000019482
Gene: ENSMUSG00000019338
AA Change: P861L

DomainStartEndE-ValueType
low complexity region 30 45 N/A INTRINSIC
low complexity region 170 186 N/A INTRINSIC
low complexity region 296 306 N/A INTRINSIC
low complexity region 312 325 N/A INTRINSIC
ZnF_C2H2 533 553 4.74e1 SMART
ZnF_C2H2 561 585 1.43e1 SMART
low complexity region 615 634 N/A INTRINSIC
low complexity region 639 667 N/A INTRINSIC
ZnF_C2H2 673 693 7.37e1 SMART
ZnF_C2H2 705 727 1.99e0 SMART
ZnF_C2H2 733 757 3.38e1 SMART
ZnF_C2H2 764 787 2.67e-1 SMART
ZnF_C2H2 792 815 4.4e-2 SMART
ZnF_C2H2 827 849 7.67e-2 SMART
ZnF_C2H2 858 881 2.36e-2 SMART
low complexity region 884 898 N/A INTRINSIC
low complexity region 914 938 N/A INTRINSIC
ZnF_C2H2 964 987 4.05e-1 SMART
ZnF_C2H2 994 1017 1.38e-3 SMART
ZnF_C2H2 1024 1050 4.65e-1 SMART
low complexity region 1057 1075 N/A INTRINSIC
low complexity region 1100 1114 N/A INTRINSIC
ZnF_C2H2 1135 1158 4.98e-1 SMART
ZnF_C2H2 1200 1222 1.82e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000072287
SMART Domains Protein: ENSMUSP00000072134
Gene: ENSMUSG00000038861

DomainStartEndE-ValueType
low complexity region 10 31 N/A INTRINSIC
SCOP:d1e8xa1 140 231 5e-22 SMART
PI3Kc 545 799 6.47e-105 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107251
SMART Domains Protein: ENSMUSP00000102872
Gene: ENSMUSG00000038861

DomainStartEndE-ValueType
low complexity region 10 31 N/A INTRINSIC
SCOP:d1e8xa1 140 231 5e-22 SMART
PI3Kc 560 814 6.47e-105 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125476
SMART Domains Protein: ENSMUSP00000121965
Gene: ENSMUSG00000038861

DomainStartEndE-ValueType
low complexity region 22 43 N/A INTRINSIC
SCOP:d1e8xa1 152 243 5e-22 SMART
PI3Kc 572 826 6.47e-105 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126222
Predicted Effect probably benign
Transcript: ENSMUST00000128438
SMART Domains Protein: ENSMUSP00000119354
Gene: ENSMUSG00000019338

DomainStartEndE-ValueType
low complexity region 30 45 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132195
SMART Domains Protein: ENSMUSP00000117308
Gene: ENSMUSG00000019338

DomainStartEndE-ValueType
low complexity region 30 45 N/A INTRINSIC
low complexity region 170 186 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133166
Predicted Effect probably benign
Transcript: ENSMUST00000133297
SMART Domains Protein: ENSMUSP00000123529
Gene: ENSMUSG00000038861

DomainStartEndE-ValueType
PI3Kc 1 225 7.13e-43 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133494
Predicted Effect probably benign
Transcript: ENSMUST00000137799
SMART Domains Protein: ENSMUSP00000123335
Gene: ENSMUSG00000019338

DomainStartEndE-ValueType
low complexity region 30 45 N/A INTRINSIC
low complexity region 170 186 N/A INTRINSIC
low complexity region 296 306 N/A INTRINSIC
low complexity region 312 325 N/A INTRINSIC
ZnF_C2H2 533 553 4.74e1 SMART
ZnF_C2H2 561 585 1.43e1 SMART
low complexity region 615 634 N/A INTRINSIC
low complexity region 639 667 N/A INTRINSIC
ZnF_C2H2 673 693 7.37e1 SMART
ZnF_C2H2 705 727 1.99e0 SMART
ZnF_C2H2 733 757 3.38e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143287
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146169
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147022
Predicted Effect probably benign
Transcript: ENSMUST00000149747
SMART Domains Protein: ENSMUSP00000116053
Gene: ENSMUSG00000019338

DomainStartEndE-ValueType
low complexity region 30 45 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167008
SMART Domains Protein: ENSMUSP00000132150
Gene: ENSMUSG00000038861

DomainStartEndE-ValueType
PI3Kc 228 482 6.47e-105 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183540
Meta Mutation Damage Score 0.2700 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 95% (69/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes C2H2 zinc finger protein. The encoded protein may play a role in bone differentiation and development. Mutations in this gene are the cause of Paget disease of bone-6. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933409G03Rik A T 2: 68,615,147 probably benign Het
Aimp1 A T 3: 132,667,492 L229Q probably benign Het
Ankrd16 T A 2: 11,784,404 D267E possibly damaging Het
Apol11b A G 15: 77,637,933 probably null Het
Arfgap1 C A 2: 180,981,076 D327E probably benign Het
Arid3b A T 9: 57,833,868 D98E probably benign Het
Art2b T A 7: 101,579,922 I257F probably benign Het
Atp5a1 T A 18: 77,780,066 probably benign Het
Carmil3 A G 14: 55,501,471 T861A probably benign Het
Cep164 A T 9: 45,779,704 F1259L possibly damaging Het
Chrnd T C 1: 87,195,790 V350A probably benign Het
Clcn7 T C 17: 25,160,176 L744P probably damaging Het
Csl T A 10: 99,758,591 D204V possibly damaging Het
Cyp2c29 G T 19: 39,287,176 W20L probably damaging Het
Dhrs13 G T 11: 78,037,125 G266* probably null Het
Dll3 T C 7: 28,296,291 N362D probably damaging Het
Fanca A G 8: 123,288,793 V715A probably benign Het
Fhod1 T C 8: 105,337,351 probably benign Het
Fpr2 C T 17: 17,893,132 P130L probably damaging Het
Glce A G 9: 62,060,253 Y539H probably damaging Het
Gm11639 T G 11: 104,736,114 probably null Het
Gm4758 A G 16: 36,312,589 D76G probably null Het
Hfe A T 13: 23,706,883 V91E probably benign Het
Hoxd13 A T 2: 74,669,957 K281* probably null Het
Ighv1-66 A T 12: 115,593,537 W3R probably damaging Het
Impg2 G A 16: 56,260,025 V622I possibly damaging Het
Jun A G 4: 95,050,847 M142T probably benign Het
Krt78 T C 15: 101,947,940 T479A probably benign Het
Lama3 T A 18: 12,519,872 C216* probably null Het
Lin54 G T 5: 100,446,560 T582K probably damaging Het
Maats1 G T 16: 38,320,365 P409T probably damaging Het
Mapk11 A G 15: 89,145,373 probably null Het
Mindy3 A G 2: 12,348,199 M397T probably benign Het
Mrpl41 T C 2: 24,974,406 T85A possibly damaging Het
Msh6 T A 17: 87,990,789 L1354* probably null Het
Mtmr12 T C 15: 12,230,314 V41A probably damaging Het
Myh2 A T 11: 67,192,725 Q1478L probably benign Het
Myo6 A G 9: 80,288,038 K897E probably benign Het
Naprt G T 15: 75,892,756 probably null Het
Nrl G A 14: 55,522,218 S84L probably benign Het
Nxf1 A G 19: 8,766,764 probably benign Het
Olfr971 A T 9: 39,840,356 R307S possibly damaging Het
Panx2 G T 15: 89,068,220 V305F probably benign Het
Pcdhga1 T C 18: 37,662,579 L212P probably damaging Het
Pik3ap1 G A 19: 41,375,881 T133I probably benign Het
Ppat A G 5: 76,915,214 W517R probably damaging Het
Ppp1r16b C T 2: 158,757,254 T382I probably benign Het
Prkdc A G 16: 15,773,739 K2694E probably damaging Het
Prkdc G A 16: 15,836,082 R3901H probably damaging Het
Psma8 A G 18: 14,721,190 I42M probably damaging Het
Ptprd A T 4: 76,102,963 M599K probably benign Het
Rnmt A G 18: 68,311,671 D237G probably null Het
Rpl31-ps17 C T 12: 54,701,612 noncoding transcript Het
Scaf11 G A 15: 96,418,428 T1085I possibly damaging Het
Sec14l3 G A 11: 4,066,210 R43Q probably damaging Het
Shc4 G T 2: 125,652,522 T131K probably benign Het
Snx27 A G 3: 94,562,023 F4L probably benign Het
Sorcs1 T C 19: 50,378,941 T228A probably damaging Het
Sptan1 C T 2: 30,029,709 probably benign Het
Syvn1 C T 19: 6,049,921 probably benign Het
Tex47 G T 5: 7,305,364 A182S probably benign Het
Thegl T C 5: 77,054,536 I268T possibly damaging Het
Tpcn1 T C 5: 120,542,518 K549R probably damaging Het
Upf3a C A 8: 13,796,573 P318T probably benign Het
Zbtb40 A T 4: 136,998,694 M518K probably damaging Het
Zcchc14 G A 8: 121,651,941 probably benign Het
Other mutations in Zfp687
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Zfp687 APN 3 95012416 missense probably damaging 1.00
IGL00510:Zfp687 APN 3 95008447 missense probably damaging 1.00
IGL00824:Zfp687 APN 3 95009185 missense probably damaging 1.00
IGL01861:Zfp687 APN 3 95011860 missense probably damaging 1.00
IGL02167:Zfp687 APN 3 95010530 missense probably benign
IGL02169:Zfp687 APN 3 95011432 missense probably damaging 1.00
IGL02260:Zfp687 APN 3 95011264 missense possibly damaging 0.92
IGL02539:Zfp687 APN 3 95011062 missense probably damaging 0.99
IGL02710:Zfp687 APN 3 95008773 missense probably benign 0.01
IGL02891:Zfp687 APN 3 95011946 missense probably damaging 0.97
IGL03186:Zfp687 APN 3 95011094 missense probably benign
R0006:Zfp687 UTSW 3 95011456 missense probably damaging 0.99
R0006:Zfp687 UTSW 3 95011456 missense probably damaging 0.99
R0243:Zfp687 UTSW 3 95011553 missense probably damaging 0.99
R0556:Zfp687 UTSW 3 95010408 missense probably damaging 1.00
R1111:Zfp687 UTSW 3 95009512 missense probably damaging 1.00
R1170:Zfp687 UTSW 3 95008473 missense probably damaging 1.00
R1236:Zfp687 UTSW 3 95012044 missense probably benign 0.01
R1482:Zfp687 UTSW 3 95007533 missense probably damaging 1.00
R1711:Zfp687 UTSW 3 95011889 missense probably benign 0.00
R2255:Zfp687 UTSW 3 95010437 missense probably damaging 1.00
R3763:Zfp687 UTSW 3 95012080 missense probably damaging 1.00
R3848:Zfp687 UTSW 3 95007914 missense probably damaging 1.00
R3850:Zfp687 UTSW 3 95007914 missense probably damaging 1.00
R4630:Zfp687 UTSW 3 95012488 splice site probably null
R4989:Zfp687 UTSW 3 95010386 missense probably damaging 1.00
R5119:Zfp687 UTSW 3 95011676 missense probably benign 0.28
R5134:Zfp687 UTSW 3 95010386 missense probably damaging 1.00
R5249:Zfp687 UTSW 3 95009466 missense probably damaging 1.00
R5408:Zfp687 UTSW 3 95009275 unclassified probably benign
R5454:Zfp687 UTSW 3 95009146 missense probably damaging 1.00
R5732:Zfp687 UTSW 3 95011217 missense possibly damaging 0.50
R5883:Zfp687 UTSW 3 95012044 missense probably benign 0.01
R6342:Zfp687 UTSW 3 95011877 missense probably benign 0.01
R6395:Zfp687 UTSW 3 95007738 missense possibly damaging 0.48
R6463:Zfp687 UTSW 3 95010784 missense probably damaging 1.00
R6575:Zfp687 UTSW 3 95008389 missense probably damaging 1.00
R6972:Zfp687 UTSW 3 95009377 missense possibly damaging 0.65
R6973:Zfp687 UTSW 3 95009377 missense possibly damaging 0.65
R7087:Zfp687 UTSW 3 95010213 missense probably benign 0.08
R7407:Zfp687 UTSW 3 95007530 missense probably damaging 1.00
R7408:Zfp687 UTSW 3 95007530 missense probably damaging 1.00
R7483:Zfp687 UTSW 3 95007530 missense probably damaging 1.00
R7492:Zfp687 UTSW 3 95007530 missense probably damaging 1.00
R7514:Zfp687 UTSW 3 95007530 missense probably damaging 1.00
R7849:Zfp687 UTSW 3 95010362 missense possibly damaging 0.65
R7932:Zfp687 UTSW 3 95010362 missense possibly damaging 0.65
Z1176:Zfp687 UTSW 3 95007701 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCTTTGCCAAAGTCCTCAC -3'
(R):5'- CATGGCCTTCAAGTCTGCAC -3'

Sequencing Primer
(F):5'- TGCCAAAGTCCTCACTTCAC -3'
(R):5'- TTCAAGTCTGCACCCAGC -3'
Posted On2015-07-07