Incidental Mutation 'R4424:Ppat'
ID 327258
Institutional Source Beutler Lab
Gene Symbol Ppat
Ensembl Gene ENSMUSG00000029246
Gene Name phosphoribosyl pyrophosphate amidotransferase
Synonyms 5730454C12Rik
MMRRC Submission 041696-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.966) question?
Stock # R4424 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 77061096-77099425 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 77063061 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Arginine at position 517 (W517R)
Ref Sequence ENSEMBL: ENSMUSP00000120632 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000140076] [ENSMUST00000155272]
AlphaFold Q8CIH9
Predicted Effect noncoding transcript
Transcript: ENSMUST00000031158
Predicted Effect probably damaging
Transcript: ENSMUST00000140076
AA Change: W517R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000120632
Gene: ENSMUSG00000029246
AA Change: W517R

DomainStartEndE-ValueType
Pfam:GATase_4 27 218 4e-11 PFAM
Pfam:GATase_6 74 216 1.6e-18 PFAM
Pfam:GATase_7 91 241 1.6e-16 PFAM
Pfam:Pribosyltran 309 420 1.3e-9 PFAM
low complexity region 474 482 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000155272
SMART Domains Protein: ENSMUSP00000116438
Gene: ENSMUSG00000029246

DomainStartEndE-ValueType
SCOP:d1ecfa2 12 43 6e-3 SMART
Meta Mutation Damage Score 0.6552 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 95% (69/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the purine/pyrimidine phosphoribosyltransferase family. It is a regulatory allosteric enzyme that catalyzes the first step of de novo purine nucleotide biosythetic pathway. This gene and PAICS/AIRC gene, a bifunctional enzyme catalyzing steps six and seven of this pathway, are located in close proximity on chromosome 4, and divergently transcribed from an intergenic region. [provided by RefSeq, Mar 2011]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933409G03Rik A T 2: 68,445,491 (GRCm39) probably benign Het
Aimp1 A T 3: 132,373,253 (GRCm39) L229Q probably benign Het
Ankrd16 T A 2: 11,789,215 (GRCm39) D267E possibly damaging Het
Apol11b A G 15: 77,522,133 (GRCm39) probably null Het
Arfgap1 C A 2: 180,622,869 (GRCm39) D327E probably benign Het
Arid3b A T 9: 57,741,151 (GRCm39) D98E probably benign Het
Art2b T A 7: 101,229,129 (GRCm39) I257F probably benign Het
Atp5f1a T A 18: 77,867,766 (GRCm39) probably benign Het
Carmil3 A G 14: 55,738,928 (GRCm39) T861A probably benign Het
Cep164 A T 9: 45,691,002 (GRCm39) F1259L possibly damaging Het
Cfap91 G T 16: 38,140,727 (GRCm39) P409T probably damaging Het
Chrnd T C 1: 87,123,512 (GRCm39) V350A probably benign Het
Clcn7 T C 17: 25,379,150 (GRCm39) L744P probably damaging Het
Csl T A 10: 99,594,453 (GRCm39) D204V possibly damaging Het
Cstdc3 A G 16: 36,132,951 (GRCm39) D76G probably null Het
Cyp2c29 G T 19: 39,275,620 (GRCm39) W20L probably damaging Het
Dhrs13 G T 11: 77,927,951 (GRCm39) G266* probably null Het
Dll3 T C 7: 27,995,716 (GRCm39) N362D probably damaging Het
Efcab3 T G 11: 104,626,940 (GRCm39) probably null Het
Fanca A G 8: 124,015,532 (GRCm39) V715A probably benign Het
Fhod1 T C 8: 106,063,983 (GRCm39) probably benign Het
Fpr2 C T 17: 18,113,394 (GRCm39) P130L probably damaging Het
Glce A G 9: 61,967,535 (GRCm39) Y539H probably damaging Het
Hfe A T 13: 23,890,866 (GRCm39) V91E probably benign Het
Hoxd13 A T 2: 74,500,301 (GRCm39) K281* probably null Het
Ighv1-66 A T 12: 115,557,157 (GRCm39) W3R probably damaging Het
Impg2 G A 16: 56,080,388 (GRCm39) V622I possibly damaging Het
Jun A G 4: 94,939,084 (GRCm39) M142T probably benign Het
Krt78 T C 15: 101,856,375 (GRCm39) T479A probably benign Het
Lama3 T A 18: 12,652,929 (GRCm39) C216* probably null Het
Lin54 G T 5: 100,594,419 (GRCm39) T582K probably damaging Het
Mapk11 A G 15: 89,029,576 (GRCm39) probably null Het
Mindy3 A G 2: 12,353,010 (GRCm39) M397T probably benign Het
Mrpl41 T C 2: 24,864,418 (GRCm39) T85A possibly damaging Het
Msh6 T A 17: 88,298,217 (GRCm39) L1354* probably null Het
Mtmr12 T C 15: 12,230,400 (GRCm39) V41A probably damaging Het
Myh2 A T 11: 67,083,551 (GRCm39) Q1478L probably benign Het
Myo6 A G 9: 80,195,320 (GRCm39) K897E probably benign Het
Naprt G T 15: 75,764,605 (GRCm39) probably null Het
Nrl G A 14: 55,759,675 (GRCm39) S84L probably benign Het
Nxf1 A G 19: 8,744,128 (GRCm39) probably benign Het
Or8g2b A T 9: 39,751,652 (GRCm39) R307S possibly damaging Het
Panx2 G T 15: 88,952,423 (GRCm39) V305F probably benign Het
Pcdhga1 T C 18: 37,795,632 (GRCm39) L212P probably damaging Het
Pik3ap1 G A 19: 41,364,320 (GRCm39) T133I probably benign Het
Ppp1r16b C T 2: 158,599,174 (GRCm39) T382I probably benign Het
Prkdc G A 16: 15,653,946 (GRCm39) R3901H probably damaging Het
Prkdc A G 16: 15,591,603 (GRCm39) K2694E probably damaging Het
Psma8 A G 18: 14,854,247 (GRCm39) I42M probably damaging Het
Ptprd A T 4: 76,021,200 (GRCm39) M599K probably benign Het
Rnmt A G 18: 68,444,742 (GRCm39) D237G probably null Het
Rpl31-ps17 C T 12: 54,748,397 (GRCm39) noncoding transcript Het
Scaf11 G A 15: 96,316,309 (GRCm39) T1085I possibly damaging Het
Sec14l3 G A 11: 4,016,210 (GRCm39) R43Q probably damaging Het
Shc4 G T 2: 125,494,442 (GRCm39) T131K probably benign Het
Snx27 A G 3: 94,469,330 (GRCm39) F4L probably benign Het
Sorcs1 T C 19: 50,367,379 (GRCm39) T228A probably damaging Het
Spmap2l T C 5: 77,202,383 (GRCm39) I268T possibly damaging Het
Sptan1 C T 2: 29,919,721 (GRCm39) probably benign Het
Syvn1 C T 19: 6,099,951 (GRCm39) probably benign Het
Tex47 G T 5: 7,355,364 (GRCm39) A182S probably benign Het
Tpcn1 T C 5: 120,680,583 (GRCm39) K549R probably damaging Het
Upf3a C A 8: 13,846,573 (GRCm39) P318T probably benign Het
Zbtb40 A T 4: 136,726,005 (GRCm39) M518K probably damaging Het
Zcchc14 G A 8: 122,378,680 (GRCm39) probably benign Het
Zfp687 G A 3: 94,916,439 (GRCm39) P861L probably damaging Het
Other mutations in Ppat
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02545:Ppat APN 5 77,063,079 (GRCm39) missense probably damaging 1.00
IGL02679:Ppat APN 5 77,067,316 (GRCm39) missense probably benign 0.10
R0836:Ppat UTSW 5 77,070,348 (GRCm39) missense probably benign 0.09
R2327:Ppat UTSW 5 77,070,314 (GRCm39) missense possibly damaging 0.94
R2850:Ppat UTSW 5 77,067,222 (GRCm39) missense probably benign
R3434:Ppat UTSW 5 77,065,912 (GRCm39) missense probably damaging 0.99
R4301:Ppat UTSW 5 77,076,348 (GRCm39) intron probably benign
R4422:Ppat UTSW 5 77,063,061 (GRCm39) missense probably damaging 1.00
R4423:Ppat UTSW 5 77,063,061 (GRCm39) missense probably damaging 1.00
R4839:Ppat UTSW 5 77,098,811 (GRCm39) nonsense probably null
R4872:Ppat UTSW 5 77,074,640 (GRCm39) missense probably damaging 0.99
R5007:Ppat UTSW 5 77,076,525 (GRCm39) intron probably benign
R5010:Ppat UTSW 5 77,076,525 (GRCm39) intron probably benign
R5325:Ppat UTSW 5 77,076,269 (GRCm39) intron probably benign
R5982:Ppat UTSW 5 77,063,112 (GRCm39) missense probably benign
R6209:Ppat UTSW 5 77,065,993 (GRCm39) missense probably benign 0.00
R6225:Ppat UTSW 5 77,070,202 (GRCm39) missense probably damaging 0.99
R6287:Ppat UTSW 5 77,066,061 (GRCm39) nonsense probably null
R7367:Ppat UTSW 5 77,067,711 (GRCm39) nonsense probably null
R7426:Ppat UTSW 5 77,063,826 (GRCm39) missense probably damaging 0.99
R7945:Ppat UTSW 5 77,063,238 (GRCm39) missense probably benign 0.01
R8047:Ppat UTSW 5 77,073,557 (GRCm39) missense probably damaging 1.00
R9343:Ppat UTSW 5 77,063,884 (GRCm39) missense probably benign 0.32
Predicted Primers PCR Primer
(F):5'- TGCCTTCTCTCGAGTGAAAAG -3'
(R):5'- TCAGTGGAAGGACTGGTTTC -3'

Sequencing Primer
(F):5'- CTTCTCTCGAGTGAAAAGTCAGTC -3'
(R):5'- GACTGGTTTCATCTGTGCAACAAG -3'
Posted On 2015-07-07