Incidental Mutation 'R4424:Lin54'
ID327260
Institutional Source Beutler Lab
Gene Symbol Lin54
Ensembl Gene ENSMUSG00000035310
Gene Namelin-54 homolog (C. elegans)
Synonyms
MMRRC Submission 041696-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.952) question?
Stock #R4424 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location100441918-100500639 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 100446560 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 582 (T582K)
Ref Sequence ENSEMBL: ENSMUSP00000121902 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046154] [ENSMUST00000123572] [ENSMUST00000137750] [ENSMUST00000139234] [ENSMUST00000144030] [ENSMUST00000149714] [ENSMUST00000152387] [ENSMUST00000154921]
Predicted Effect possibly damaging
Transcript: ENSMUST00000046154
AA Change: T671K

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000041374
Gene: ENSMUSG00000035310
AA Change: T671K

DomainStartEndE-ValueType
low complexity region 364 382 N/A INTRINSIC
low complexity region 404 419 N/A INTRINSIC
CXC 520 560 3.06e-15 SMART
CXC 594 635 1.84e-18 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000123572
AA Change: T671K

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000123425
Gene: ENSMUSG00000035310
AA Change: T671K

DomainStartEndE-ValueType
low complexity region 364 382 N/A INTRINSIC
low complexity region 404 419 N/A INTRINSIC
CXC 520 560 3.06e-15 SMART
CXC 594 635 1.84e-18 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000137750
AA Change: T450K

PolyPhen 2 Score 0.754 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000120644
Gene: ENSMUSG00000035310
AA Change: T450K

DomainStartEndE-ValueType
low complexity region 143 161 N/A INTRINSIC
low complexity region 183 198 N/A INTRINSIC
CXC 299 339 3.06e-15 SMART
CXC 373 414 1.84e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000139234
SMART Domains Protein: ENSMUSP00000119322
Gene: ENSMUSG00000035310

DomainStartEndE-ValueType
low complexity region 218 229 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000144030
Predicted Effect possibly damaging
Transcript: ENSMUST00000149714
AA Change: T450K

PolyPhen 2 Score 0.754 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000123544
Gene: ENSMUSG00000035310
AA Change: T450K

DomainStartEndE-ValueType
low complexity region 143 161 N/A INTRINSIC
low complexity region 183 198 N/A INTRINSIC
CXC 299 339 3.06e-15 SMART
CXC 373 414 1.84e-18 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000152387
AA Change: T582K

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000121902
Gene: ENSMUSG00000035310
AA Change: T582K

DomainStartEndE-ValueType
low complexity region 218 231 N/A INTRINSIC
low complexity region 275 293 N/A INTRINSIC
low complexity region 315 330 N/A INTRINSIC
CXC 431 471 3.06e-15 SMART
CXC 505 546 1.84e-18 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000154921
AA Change: T450K

PolyPhen 2 Score 0.754 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000121137
Gene: ENSMUSG00000035310
AA Change: T450K

DomainStartEndE-ValueType
low complexity region 143 161 N/A INTRINSIC
low complexity region 183 198 N/A INTRINSIC
CXC 299 339 3.06e-15 SMART
CXC 373 414 1.84e-18 SMART
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 95% (69/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] LIN54 is a component of the LIN, or DREAM, complex, an essential regulator of cell cycle genes (Schmit et al., 2009 [PubMed 19725879]).[supplied by OMIM, Dec 2010]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933409G03Rik A T 2: 68,615,147 probably benign Het
Aimp1 A T 3: 132,667,492 L229Q probably benign Het
Ankrd16 T A 2: 11,784,404 D267E possibly damaging Het
Apol11b A G 15: 77,637,933 probably null Het
Arfgap1 C A 2: 180,981,076 D327E probably benign Het
Arid3b A T 9: 57,833,868 D98E probably benign Het
Art2b T A 7: 101,579,922 I257F probably benign Het
Atp5a1 T A 18: 77,780,066 probably benign Het
Carmil3 A G 14: 55,501,471 T861A probably benign Het
Cep164 A T 9: 45,779,704 F1259L possibly damaging Het
Chrnd T C 1: 87,195,790 V350A probably benign Het
Clcn7 T C 17: 25,160,176 L744P probably damaging Het
Csl T A 10: 99,758,591 D204V possibly damaging Het
Cyp2c29 G T 19: 39,287,176 W20L probably damaging Het
Dhrs13 G T 11: 78,037,125 G266* probably null Het
Dll3 T C 7: 28,296,291 N362D probably damaging Het
Fanca A G 8: 123,288,793 V715A probably benign Het
Fhod1 T C 8: 105,337,351 probably benign Het
Fpr2 C T 17: 17,893,132 P130L probably damaging Het
Glce A G 9: 62,060,253 Y539H probably damaging Het
Gm11639 T G 11: 104,736,114 probably null Het
Gm4758 A G 16: 36,312,589 D76G probably null Het
Hfe A T 13: 23,706,883 V91E probably benign Het
Hoxd13 A T 2: 74,669,957 K281* probably null Het
Ighv1-66 A T 12: 115,593,537 W3R probably damaging Het
Impg2 G A 16: 56,260,025 V622I possibly damaging Het
Jun A G 4: 95,050,847 M142T probably benign Het
Krt78 T C 15: 101,947,940 T479A probably benign Het
Lama3 T A 18: 12,519,872 C216* probably null Het
Maats1 G T 16: 38,320,365 P409T probably damaging Het
Mapk11 A G 15: 89,145,373 probably null Het
Mindy3 A G 2: 12,348,199 M397T probably benign Het
Mrpl41 T C 2: 24,974,406 T85A possibly damaging Het
Msh6 T A 17: 87,990,789 L1354* probably null Het
Mtmr12 T C 15: 12,230,314 V41A probably damaging Het
Myh2 A T 11: 67,192,725 Q1478L probably benign Het
Myo6 A G 9: 80,288,038 K897E probably benign Het
Naprt G T 15: 75,892,756 probably null Het
Nrl G A 14: 55,522,218 S84L probably benign Het
Nxf1 A G 19: 8,766,764 probably benign Het
Olfr971 A T 9: 39,840,356 R307S possibly damaging Het
Panx2 G T 15: 89,068,220 V305F probably benign Het
Pcdhga1 T C 18: 37,662,579 L212P probably damaging Het
Pik3ap1 G A 19: 41,375,881 T133I probably benign Het
Ppat A G 5: 76,915,214 W517R probably damaging Het
Ppp1r16b C T 2: 158,757,254 T382I probably benign Het
Prkdc A G 16: 15,773,739 K2694E probably damaging Het
Prkdc G A 16: 15,836,082 R3901H probably damaging Het
Psma8 A G 18: 14,721,190 I42M probably damaging Het
Ptprd A T 4: 76,102,963 M599K probably benign Het
Rnmt A G 18: 68,311,671 D237G probably null Het
Rpl31-ps17 C T 12: 54,701,612 noncoding transcript Het
Scaf11 G A 15: 96,418,428 T1085I possibly damaging Het
Sec14l3 G A 11: 4,066,210 R43Q probably damaging Het
Shc4 G T 2: 125,652,522 T131K probably benign Het
Snx27 A G 3: 94,562,023 F4L probably benign Het
Sorcs1 T C 19: 50,378,941 T228A probably damaging Het
Sptan1 C T 2: 30,029,709 probably benign Het
Syvn1 C T 19: 6,049,921 probably benign Het
Tex47 G T 5: 7,305,364 A182S probably benign Het
Thegl T C 5: 77,054,536 I268T possibly damaging Het
Tpcn1 T C 5: 120,542,518 K549R probably damaging Het
Upf3a C A 8: 13,796,573 P318T probably benign Het
Zbtb40 A T 4: 136,998,694 M518K probably damaging Het
Zcchc14 G A 8: 121,651,941 probably benign Het
Zfp687 G A 3: 95,009,128 P861L probably damaging Het
Other mutations in Lin54
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01286:Lin54 APN 5 100485607 missense probably benign 0.03
IGL01356:Lin54 APN 5 100454017 missense probably damaging 0.98
IGL02931:Lin54 APN 5 100480321 missense possibly damaging 0.93
IGL03089:Lin54 APN 5 100450993 missense probably damaging 1.00
IGL03095:Lin54 APN 5 100454478 missense probably damaging 0.99
IGL03202:Lin54 APN 5 100475814 missense possibly damaging 0.92
R0505:Lin54 UTSW 5 100452293 missense probably damaging 0.98
R1138:Lin54 UTSW 5 100444134 missense probably damaging 0.98
R1540:Lin54 UTSW 5 100480250 missense probably damaging 0.99
R1719:Lin54 UTSW 5 100485249 missense possibly damaging 0.91
R1991:Lin54 UTSW 5 100485801 critical splice donor site probably null
R2698:Lin54 UTSW 5 100480250 missense probably damaging 0.99
R3738:Lin54 UTSW 5 100459806 splice site probably benign
R4238:Lin54 UTSW 5 100475744 missense possibly damaging 0.45
R4529:Lin54 UTSW 5 100446560 missense possibly damaging 0.91
R4530:Lin54 UTSW 5 100446560 missense possibly damaging 0.91
R4531:Lin54 UTSW 5 100446560 missense possibly damaging 0.91
R4532:Lin54 UTSW 5 100446560 missense possibly damaging 0.91
R4533:Lin54 UTSW 5 100485403 missense possibly damaging 0.79
R4665:Lin54 UTSW 5 100453084 missense possibly damaging 0.92
R4784:Lin54 UTSW 5 100459738 missense probably damaging 0.99
R4785:Lin54 UTSW 5 100459738 missense probably damaging 0.99
R5252:Lin54 UTSW 5 100480204 missense probably benign
R5265:Lin54 UTSW 5 100485519 missense probably damaging 1.00
R6545:Lin54 UTSW 5 100485137 splice site probably null
R7150:Lin54 UTSW 5 100485300 missense possibly damaging 0.74
R7544:Lin54 UTSW 5 100485270 missense possibly damaging 0.84
R8165:Lin54 UTSW 5 100454499 missense probably benign 0.11
R8767:Lin54 UTSW 5 100453025 missense probably benign 0.27
R8940:Lin54 UTSW 5 100446671 missense probably damaging 1.00
X0025:Lin54 UTSW 5 100454443 missense probably benign 0.11
X0026:Lin54 UTSW 5 100450999 missense probably damaging 0.97
Z1189:Lin54 UTSW 5 100459781 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACTTTGTGGCTCAGTCTGGC -3'
(R):5'- ACTGCTTCATCTAAGATACCTGTTG -3'

Sequencing Primer
(F):5'- CTGGGAATTAAACTCAGGACCTTCG -3'
(R):5'- GATACCTGTTGACAAGCTAATGC -3'
Posted On2015-07-07