Mutagenetix > Incidental Mutations

Incidental Mutation 'R4424:Upf3a'

327264

Institutional Source

Beutler Lab

Gene Symbol

Upf3a

Ensembl Gene

ENSMUSG00000038398

Gene Name

UPF3 regulator of nonsense transcripts homolog A (yeast)

Synonyms

2600001C03Rik, RENT3A, 4930546M19Rik, UPF3

MMRRC Submission

041696-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4424 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

13785615-13799193 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 13796573 bp

Zygosity

Heterozygous

Amino Acid Change

Proline to Threonine at position 318 (P318T)

Ref Sequence

ENSEMBL: ENSMUSP00000037354 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043767]

Predicted Effect

probably benign
Transcript: ENSMUST00000043767
AA Change: P318T

PolyPhen 2 Score 0.090 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000037354
Gene: ENSMUSG00000038398
AA Change: P318T

Domain	Start	End	E-Value	Type
low complexity region	6	18	N/A	INTRINSIC
Pfam:Smg4_UPF3	63	224	1.4e-54	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000211724

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.3%

Validation Efficiency

95% (69/73)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is part of a post-splicing multiprotein complex involved in both mRNA nuclear export and mRNA surveillance. The encoded protein is one of two functional homologs to yeast Upf3p. mRNA surveillance detects exported mRNAs with truncated open reading frames and initiates nonsense-mediated mRNA decay (NMD). When translation ends upstream from the last exon-exon junction, this triggers NMD to degrade mRNAs containing premature stop codons. This protein binds to the mRNA and remains bound after nuclear export, acting as a nucleocytoplasmic shuttling protein. It forms with Y14 a complex that binds specifically 20 nt upstream of exon-exon junctions. This gene is located on the long arm of chromosome 13. Two splice variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: The gene product protects against mRNA transcript degradation. Homozygous constitutive KO is embryonic lethal. Homozygous conditional KO in testes leads to reduced male fertility. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933409G03Rik	A	T	2: 68,615,147		probably benign	Het
Aimp1	A	T	3: 132,667,492	L229Q	probably benign	Het
Ankrd16	T	A	2: 11,784,404	D267E	possibly damaging	Het
Apol11b	A	G	15: 77,637,933		probably null	Het
Arfgap1	C	A	2: 180,981,076	D327E	probably benign	Het
Arid3b	A	T	9: 57,833,868	D98E	probably benign	Het
Art2b	T	A	7: 101,579,922	I257F	probably benign	Het
Atp5a1	T	A	18: 77,780,066		probably benign	Het
Carmil3	A	G	14: 55,501,471	T861A	probably benign	Het
Cep164	A	T	9: 45,779,704	F1259L	possibly damaging	Het
Chrnd	T	C	1: 87,195,790	V350A	probably benign	Het
Clcn7	T	C	17: 25,160,176	L744P	probably damaging	Het
Csl	T	A	10: 99,758,591	D204V	possibly damaging	Het
Cyp2c29	G	T	19: 39,287,176	W20L	probably damaging	Het
Dhrs13	G	T	11: 78,037,125	G266*	probably null	Het
Dll3	T	C	7: 28,296,291	N362D	probably damaging	Het
Fanca	A	G	8: 123,288,793	V715A	probably benign	Het
Fhod1	T	C	8: 105,337,351		probably benign	Het
Fpr2	C	T	17: 17,893,132	P130L	probably damaging	Het
Glce	A	G	9: 62,060,253	Y539H	probably damaging	Het
Gm11639	T	G	11: 104,736,114		probably null	Het
Gm4758	A	G	16: 36,312,589	D76G	probably null	Het
Hfe	A	T	13: 23,706,883	V91E	probably benign	Het
Hoxd13	A	T	2: 74,669,957	K281*	probably null	Het
Ighv1-66	A	T	12: 115,593,537	W3R	probably damaging	Het
Impg2	G	A	16: 56,260,025	V622I	possibly damaging	Het
Jun	A	G	4: 95,050,847	M142T	probably benign	Het
Krt78	T	C	15: 101,947,940	T479A	probably benign	Het
Lama3	T	A	18: 12,519,872	C216*	probably null	Het
Lin54	G	T	5: 100,446,560	T582K	probably damaging	Het
Maats1	G	T	16: 38,320,365	P409T	probably damaging	Het
Mapk11	A	G	15: 89,145,373		probably null	Het
Mindy3	A	G	2: 12,348,199	M397T	probably benign	Het
Mrpl41	T	C	2: 24,974,406	T85A	possibly damaging	Het
Msh6	T	A	17: 87,990,789	L1354*	probably null	Het
Mtmr12	T	C	15: 12,230,314	V41A	probably damaging	Het
Myh2	A	T	11: 67,192,725	Q1478L	probably benign	Het
Myo6	A	G	9: 80,288,038	K897E	probably benign	Het
Naprt	G	T	15: 75,892,756		probably null	Het
Nrl	G	A	14: 55,522,218	S84L	probably benign	Het
Nxf1	A	G	19: 8,766,764		probably benign	Het
Olfr971	A	T	9: 39,840,356	R307S	possibly damaging	Het
Panx2	G	T	15: 89,068,220	V305F	probably benign	Het
Pcdhga1	T	C	18: 37,662,579	L212P	probably damaging	Het
Pik3ap1	G	A	19: 41,375,881	T133I	probably benign	Het
Ppat	A	G	5: 76,915,214	W517R	probably damaging	Het
Ppp1r16b	C	T	2: 158,757,254	T382I	probably benign	Het
Prkdc	A	G	16: 15,773,739	K2694E	probably damaging	Het
Prkdc	G	A	16: 15,836,082	R3901H	probably damaging	Het
Psma8	A	G	18: 14,721,190	I42M	probably damaging	Het
Ptprd	A	T	4: 76,102,963	M599K	probably benign	Het
Rnmt	A	G	18: 68,311,671	D237G	probably null	Het
Rpl31-ps17	C	T	12: 54,701,612		noncoding transcript	Het
Scaf11	G	A	15: 96,418,428	T1085I	possibly damaging	Het
Sec14l3	G	A	11: 4,066,210	R43Q	probably damaging	Het
Shc4	G	T	2: 125,652,522	T131K	probably benign	Het
Snx27	A	G	3: 94,562,023	F4L	probably benign	Het
Sorcs1	T	C	19: 50,378,941	T228A	probably damaging	Het
Sptan1	C	T	2: 30,029,709		probably benign	Het
Syvn1	C	T	19: 6,049,921		probably benign	Het
Tex47	G	T	5: 7,305,364	A182S	probably benign	Het
Thegl	T	C	5: 77,054,536	I268T	possibly damaging	Het
Tpcn1	T	C	5: 120,542,518	K549R	probably damaging	Het
Zbtb40	A	T	4: 136,998,694	M518K	probably damaging	Het
Zcchc14	G	A	8: 121,651,941		probably benign	Het
Zfp687	G	A	3: 95,009,128	P861L	probably damaging	Het

Other mutations in Upf3a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01398:Upf3a	APN	8	13786221	missense	probably damaging	0.98
IGL01678:Upf3a	APN	8	13791930	missense	probably benign	0.21
IGL02072:Upf3a	APN	8	13798368	missense	probably damaging	0.99
R0309:Upf3a	UTSW	8	13795500	splice site	probably null
R0564:Upf3a	UTSW	8	13795656	missense	probably benign	0.42
R0571:Upf3a	UTSW	8	13792184	missense	probably damaging	0.98
R0826:Upf3a	UTSW	8	13798338	missense	possibly damaging	0.65
R1387:Upf3a	UTSW	8	13792118	missense	probably damaging	1.00
R1913:Upf3a	UTSW	8	13792108	missense	probably damaging	1.00
R2072:Upf3a	UTSW	8	13785850	missense	possibly damaging	0.63
R2520:Upf3a	UTSW	8	13796443	splice site	probably null
R3845:Upf3a	UTSW	8	13798238	missense	probably benign	0.16
R4239:Upf3a	UTSW	8	13796591	missense	probably benign	0.28
R5522:Upf3a	UTSW	8	13795497	critical splice donor site	probably null
R6321:Upf3a	UTSW	8	13787466	missense	possibly damaging	0.53
R6922:Upf3a	UTSW	8	13791911	missense	probably damaging	1.00
R7583:Upf3a	UTSW	8	13785889	splice site	probably null
R7585:Upf3a	UTSW	8	13787418	missense	probably damaging	1.00
R7695:Upf3a	UTSW	8	13798279	missense	probably benign	0.01
R7991:Upf3a	UTSW	8	13792166	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TACGTACGGGCCATATCCATG -3'
(R):5'- TAAGCTGATACTGGGGCTCTGG -3'

Sequencing Primer
(F):5'- TAGCAAAGTCTGTATGTATGTGCCCC -3'
(R):5'- CTCTGGGTCAGGGCTCACTATG -3'

Posted On

2015-07-07