Incidental Mutation 'R4424:Cep164'
ID327269
Institutional Source Beutler Lab
Gene Symbol Cep164
Ensembl Gene ENSMUSG00000043987
Gene Namecentrosomal protein 164
Synonyms
MMRRC Submission 041696-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4424 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location45766946-45828691 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 45779704 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 1259 (F1259L)
Ref Sequence ENSEMBL: ENSMUSP00000149815 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000117194] [ENSMUST00000117194] [ENSMUST00000117194] [ENSMUST00000213154] [ENSMUST00000216284] [ENSMUST00000217554]
Predicted Effect probably benign
Transcript: ENSMUST00000117194
AA Change: F558L

PolyPhen 2 Score 0.271 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000114053
Gene: ENSMUSG00000043987
AA Change: F558L

DomainStartEndE-ValueType
WW 57 89 1.99e-3 SMART
low complexity region 110 127 N/A INTRINSIC
low complexity region 189 201 N/A INTRINSIC
low complexity region 210 229 N/A INTRINSIC
low complexity region 362 375 N/A INTRINSIC
coiled coil region 511 735 N/A INTRINSIC
low complexity region 741 756 N/A INTRINSIC
coiled coil region 761 931 N/A INTRINSIC
low complexity region 956 962 N/A INTRINSIC
coiled coil region 1057 1084 N/A INTRINSIC
low complexity region 1095 1110 N/A INTRINSIC
low complexity region 1141 1168 N/A INTRINSIC
low complexity region 1185 1195 N/A INTRINSIC
low complexity region 1235 1248 N/A INTRINSIC
low complexity region 1309 1318 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117194
AA Change: F558L

PolyPhen 2 Score 0.271 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000114053
Gene: ENSMUSG00000043987
AA Change: F558L

DomainStartEndE-ValueType
WW 57 89 1.99e-3 SMART
low complexity region 110 127 N/A INTRINSIC
low complexity region 189 201 N/A INTRINSIC
low complexity region 210 229 N/A INTRINSIC
low complexity region 362 375 N/A INTRINSIC
coiled coil region 511 735 N/A INTRINSIC
low complexity region 741 756 N/A INTRINSIC
coiled coil region 761 931 N/A INTRINSIC
low complexity region 956 962 N/A INTRINSIC
coiled coil region 1057 1084 N/A INTRINSIC
low complexity region 1095 1110 N/A INTRINSIC
low complexity region 1141 1168 N/A INTRINSIC
low complexity region 1185 1195 N/A INTRINSIC
low complexity region 1235 1248 N/A INTRINSIC
low complexity region 1309 1318 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117194
AA Change: F558L

PolyPhen 2 Score 0.271 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000114053
Gene: ENSMUSG00000043987
AA Change: F558L

DomainStartEndE-ValueType
WW 57 89 1.99e-3 SMART
low complexity region 110 127 N/A INTRINSIC
low complexity region 189 201 N/A INTRINSIC
low complexity region 210 229 N/A INTRINSIC
low complexity region 362 375 N/A INTRINSIC
coiled coil region 511 735 N/A INTRINSIC
low complexity region 741 756 N/A INTRINSIC
coiled coil region 761 931 N/A INTRINSIC
low complexity region 956 962 N/A INTRINSIC
coiled coil region 1057 1084 N/A INTRINSIC
low complexity region 1095 1110 N/A INTRINSIC
low complexity region 1141 1168 N/A INTRINSIC
low complexity region 1185 1195 N/A INTRINSIC
low complexity region 1235 1248 N/A INTRINSIC
low complexity region 1309 1318 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000132430
AA Change: F435L
SMART Domains Protein: ENSMUSP00000117344
Gene: ENSMUSG00000043987
AA Change: F435L

DomainStartEndE-ValueType
low complexity region 141 154 N/A INTRINSIC
coiled coil region 325 612 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000132430
AA Change: F435L
SMART Domains Protein: ENSMUSP00000117344
Gene: ENSMUSG00000043987
AA Change: F435L

DomainStartEndE-ValueType
low complexity region 141 154 N/A INTRINSIC
coiled coil region 325 612 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000132430
AA Change: F435L
SMART Domains Protein: ENSMUSP00000117344
Gene: ENSMUSG00000043987
AA Change: F435L

DomainStartEndE-ValueType
low complexity region 141 154 N/A INTRINSIC
coiled coil region 325 612 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000213154
AA Change: F1259L

PolyPhen 2 Score 0.918 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000216284
AA Change: F398L

PolyPhen 2 Score 0.459 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect probably benign
Transcript: ENSMUST00000217554
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 95% (69/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a centrosomal protein involved in microtubule organization, DNA damage response, and chromosome segregation. The encoded protein is required for assembly of primary cilia and localizes to mature centrioles. Defects in this gene are a cause of nephronophthisis-related ciliopathies. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2012]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933409G03Rik A T 2: 68,615,147 probably benign Het
Aimp1 A T 3: 132,667,492 L229Q probably benign Het
Ankrd16 T A 2: 11,784,404 D267E possibly damaging Het
Apol11b A G 15: 77,637,933 probably null Het
Arfgap1 C A 2: 180,981,076 D327E probably benign Het
Arid3b A T 9: 57,833,868 D98E probably benign Het
Art2b T A 7: 101,579,922 I257F probably benign Het
Atp5a1 T A 18: 77,780,066 probably benign Het
Carmil3 A G 14: 55,501,471 T861A probably benign Het
Chrnd T C 1: 87,195,790 V350A probably benign Het
Clcn7 T C 17: 25,160,176 L744P probably damaging Het
Csl T A 10: 99,758,591 D204V possibly damaging Het
Cyp2c29 G T 19: 39,287,176 W20L probably damaging Het
Dhrs13 G T 11: 78,037,125 G266* probably null Het
Dll3 T C 7: 28,296,291 N362D probably damaging Het
Fanca A G 8: 123,288,793 V715A probably benign Het
Fhod1 T C 8: 105,337,351 probably benign Het
Fpr2 C T 17: 17,893,132 P130L probably damaging Het
Glce A G 9: 62,060,253 Y539H probably damaging Het
Gm11639 T G 11: 104,736,114 probably null Het
Gm4758 A G 16: 36,312,589 D76G probably null Het
Hfe A T 13: 23,706,883 V91E probably benign Het
Hoxd13 A T 2: 74,669,957 K281* probably null Het
Ighv1-66 A T 12: 115,593,537 W3R probably damaging Het
Impg2 G A 16: 56,260,025 V622I possibly damaging Het
Jun A G 4: 95,050,847 M142T probably benign Het
Krt78 T C 15: 101,947,940 T479A probably benign Het
Lama3 T A 18: 12,519,872 C216* probably null Het
Lin54 G T 5: 100,446,560 T582K probably damaging Het
Maats1 G T 16: 38,320,365 P409T probably damaging Het
Mapk11 A G 15: 89,145,373 probably null Het
Mindy3 A G 2: 12,348,199 M397T probably benign Het
Mrpl41 T C 2: 24,974,406 T85A possibly damaging Het
Msh6 T A 17: 87,990,789 L1354* probably null Het
Mtmr12 T C 15: 12,230,314 V41A probably damaging Het
Myh2 A T 11: 67,192,725 Q1478L probably benign Het
Myo6 A G 9: 80,288,038 K897E probably benign Het
Naprt G T 15: 75,892,756 probably null Het
Nrl G A 14: 55,522,218 S84L probably benign Het
Nxf1 A G 19: 8,766,764 probably benign Het
Olfr971 A T 9: 39,840,356 R307S possibly damaging Het
Panx2 G T 15: 89,068,220 V305F probably benign Het
Pcdhga1 T C 18: 37,662,579 L212P probably damaging Het
Pik3ap1 G A 19: 41,375,881 T133I probably benign Het
Ppat A G 5: 76,915,214 W517R probably damaging Het
Ppp1r16b C T 2: 158,757,254 T382I probably benign Het
Prkdc A G 16: 15,773,739 K2694E probably damaging Het
Prkdc G A 16: 15,836,082 R3901H probably damaging Het
Psma8 A G 18: 14,721,190 I42M probably damaging Het
Ptprd A T 4: 76,102,963 M599K probably benign Het
Rnmt A G 18: 68,311,671 D237G probably null Het
Rpl31-ps17 C T 12: 54,701,612 noncoding transcript Het
Scaf11 G A 15: 96,418,428 T1085I possibly damaging Het
Sec14l3 G A 11: 4,066,210 R43Q probably damaging Het
Shc4 G T 2: 125,652,522 T131K probably benign Het
Snx27 A G 3: 94,562,023 F4L probably benign Het
Sorcs1 T C 19: 50,378,941 T228A probably damaging Het
Sptan1 C T 2: 30,029,709 probably benign Het
Syvn1 C T 19: 6,049,921 probably benign Het
Tex47 G T 5: 7,305,364 A182S probably benign Het
Thegl T C 5: 77,054,536 I268T possibly damaging Het
Tpcn1 T C 5: 120,542,518 K549R probably damaging Het
Upf3a C A 8: 13,796,573 P318T probably benign Het
Zbtb40 A T 4: 136,998,694 M518K probably damaging Het
Zcchc14 G A 8: 121,651,941 probably benign Het
Zfp687 G A 3: 95,009,128 P861L probably damaging Het
Other mutations in Cep164
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00983:Cep164 APN 9 45775256 missense possibly damaging 0.46
IGL01571:Cep164 APN 9 45794338 missense possibly damaging 0.82
IGL01985:Cep164 APN 9 45779606 missense probably damaging 1.00
IGL01989:Cep164 APN 9 45793015 splice site probably benign
IGL02130:Cep164 APN 9 45779792 missense possibly damaging 0.82
IGL02598:Cep164 APN 9 45770704 missense probably damaging 1.00
IGL03206:Cep164 APN 9 45802725 missense probably benign 0.00
R0063:Cep164 UTSW 9 45768618 missense possibly damaging 0.83
R0109:Cep164 UTSW 9 45771587 missense probably damaging 1.00
R0528:Cep164 UTSW 9 45776936 unclassified probably benign
R0532:Cep164 UTSW 9 45809826 nonsense probably null
R1445:Cep164 UTSW 9 45778900 missense possibly damaging 0.66
R1753:Cep164 UTSW 9 45792937 missense probably damaging 0.99
R1824:Cep164 UTSW 9 45778928 missense probably damaging 1.00
R1856:Cep164 UTSW 9 45775758 splice site probably null
R1858:Cep164 UTSW 9 45823640 splice site probably benign
R1900:Cep164 UTSW 9 45809825 missense probably damaging 1.00
R1911:Cep164 UTSW 9 45770806 missense probably benign 0.09
R2032:Cep164 UTSW 9 45771600 missense probably damaging 1.00
R2133:Cep164 UTSW 9 45803183 missense probably damaging 1.00
R2186:Cep164 UTSW 9 45768578 missense probably damaging 1.00
R2511:Cep164 UTSW 9 45775249 missense probably damaging 1.00
R5126:Cep164 UTSW 9 45787424 critical splice donor site probably null
R5997:Cep164 UTSW 9 45769463 missense possibly damaging 0.92
R6186:Cep164 UTSW 9 45794109 missense probably damaging 0.98
R6357:Cep164 UTSW 9 45770884 missense probably damaging 1.00
R6385:Cep164 UTSW 9 45779783 missense probably damaging 0.99
R6632:Cep164 UTSW 9 45779790 missense possibly damaging 0.66
R6957:Cep164 UTSW 9 45772280 critical splice donor site probably null
R7310:Cep164 UTSW 9 45775366 missense probably damaging 1.00
R7420:Cep164 UTSW 9 45768542 missense probably benign 0.01
R7651:Cep164 UTSW 9 45773852 missense probably benign 0.18
R8010:Cep164 UTSW 9 45823671 missense unknown
X0024:Cep164 UTSW 9 45775863 critical splice donor site probably null
X0028:Cep164 UTSW 9 45770967 missense probably damaging 1.00
X0065:Cep164 UTSW 9 45774787 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TGTTCCAAGCTGGCTCTTTCAG -3'
(R):5'- CTTTGTAGGTAGGCCTCGAG -3'

Sequencing Primer
(F):5'- CAGCTTTCTGGAGAGTCTCGGC -3'
(R):5'- GCTCTCAGAGATGGGTCCTAAATAC -3'
Posted On2015-07-07