Incidental Mutation 'R4424:Arid3b'
ID327270
Institutional Source Beutler Lab
Gene Symbol Arid3b
Ensembl Gene ENSMUSG00000004661
Gene NameAT rich interactive domain 3B (BRIGHT-like)
SynonymsBdp, Dri2
MMRRC Submission 041696-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4424 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location57790353-57836793 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 57833868 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 98 (D98E)
Ref Sequence ENSEMBL: ENSMUSP00000109802 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004780] [ENSMUST00000098686] [ENSMUST00000114165] [ENSMUST00000164010] [ENSMUST00000164035] [ENSMUST00000171444]
Predicted Effect probably benign
Transcript: ENSMUST00000004780
AA Change: D98E

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000004780
Gene: ENSMUSG00000004661
AA Change: D98E

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
low complexity region 88 116 N/A INTRINSIC
ARID 210 301 9.52e-35 SMART
BRIGHT 214 306 6.43e-39 SMART
low complexity region 339 358 N/A INTRINSIC
low complexity region 372 386 N/A INTRINSIC
low complexity region 528 559 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098686
AA Change: D98E

PolyPhen 2 Score 0.076 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000096283
Gene: ENSMUSG00000004661
AA Change: D98E

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
low complexity region 88 116 N/A INTRINSIC
ARID 210 301 9.52e-35 SMART
BRIGHT 214 306 6.43e-39 SMART
low complexity region 339 358 N/A INTRINSIC
low complexity region 372 386 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114165
AA Change: D98E

PolyPhen 2 Score 0.217 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000109802
Gene: ENSMUSG00000004661
AA Change: D98E

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
low complexity region 88 116 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163186
SMART Domains Protein: ENSMUSP00000130053
Gene: ENSMUSG00000091908

DomainStartEndE-ValueType
low complexity region 96 116 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164010
AA Change: D98E

PolyPhen 2 Score 0.109 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000126889
Gene: ENSMUSG00000004661
AA Change: D98E

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
low complexity region 88 116 N/A INTRINSIC
SCOP:d1c20a_ 174 240 6e-9 SMART
PDB:4LJX|B 204 238 4e-9 PDB
Blast:ARID 210 231 5e-7 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000164035
AA Change: D98E

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000131677
Gene: ENSMUSG00000004661
AA Change: D98E

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
low complexity region 88 116 N/A INTRINSIC
SCOP:d1c20a_ 174 233 2e-8 SMART
PDB:4LJX|B 204 268 1e-10 PDB
Blast:ARID 210 267 3e-8 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165858
SMART Domains Protein: ENSMUSP00000130213
Gene: ENSMUSG00000091908

DomainStartEndE-ValueType
low complexity region 96 116 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167670
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170133
Predicted Effect probably benign
Transcript: ENSMUST00000171444
AA Change: D98E

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000130173
Gene: ENSMUSG00000004661
AA Change: D98E

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
low complexity region 88 116 N/A INTRINSIC
ARID 210 301 9.52e-35 SMART
BRIGHT 214 306 6.43e-39 SMART
low complexity region 339 358 N/A INTRINSIC
low complexity region 372 386 N/A INTRINSIC
low complexity region 528 559 N/A INTRINSIC
Meta Mutation Damage Score 0.0711 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 95% (69/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ARID (AT-rich interaction domain) family of DNA-binding proteins. The encoded protein is homologous with two proteins that bind to the retinoblastoma gene product, and also with the mouse Bright and Drosophila dead ringer proteins. A pseudogene on chromosome 1p31 exists for this gene. Members of the ARID family have roles in embryonic patterning, cell lineage gene regulation, cell cycle control, transcriptional regulation and possibly in chromatin structure modification. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele die before E11.5 displaying variable phenotypes associated with impaired generation of cranial-mesenchymal cells in the first and second branchial arches. Common defects include a wavy neural tube, small branchial arches, and a defective cardiovascular system. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933409G03Rik A T 2: 68,615,147 probably benign Het
Aimp1 A T 3: 132,667,492 L229Q probably benign Het
Ankrd16 T A 2: 11,784,404 D267E possibly damaging Het
Apol11b A G 15: 77,637,933 probably null Het
Arfgap1 C A 2: 180,981,076 D327E probably benign Het
Art2b T A 7: 101,579,922 I257F probably benign Het
Atp5a1 T A 18: 77,780,066 probably benign Het
Carmil3 A G 14: 55,501,471 T861A probably benign Het
Cep164 A T 9: 45,779,704 F1259L possibly damaging Het
Chrnd T C 1: 87,195,790 V350A probably benign Het
Clcn7 T C 17: 25,160,176 L744P probably damaging Het
Csl T A 10: 99,758,591 D204V possibly damaging Het
Cyp2c29 G T 19: 39,287,176 W20L probably damaging Het
Dhrs13 G T 11: 78,037,125 G266* probably null Het
Dll3 T C 7: 28,296,291 N362D probably damaging Het
Fanca A G 8: 123,288,793 V715A probably benign Het
Fhod1 T C 8: 105,337,351 probably benign Het
Fpr2 C T 17: 17,893,132 P130L probably damaging Het
Glce A G 9: 62,060,253 Y539H probably damaging Het
Gm11639 T G 11: 104,736,114 probably null Het
Gm4758 A G 16: 36,312,589 D76G probably null Het
Hfe A T 13: 23,706,883 V91E probably benign Het
Hoxd13 A T 2: 74,669,957 K281* probably null Het
Ighv1-66 A T 12: 115,593,537 W3R probably damaging Het
Impg2 G A 16: 56,260,025 V622I possibly damaging Het
Jun A G 4: 95,050,847 M142T probably benign Het
Krt78 T C 15: 101,947,940 T479A probably benign Het
Lama3 T A 18: 12,519,872 C216* probably null Het
Lin54 G T 5: 100,446,560 T582K probably damaging Het
Maats1 G T 16: 38,320,365 P409T probably damaging Het
Mapk11 A G 15: 89,145,373 probably null Het
Mindy3 A G 2: 12,348,199 M397T probably benign Het
Mrpl41 T C 2: 24,974,406 T85A possibly damaging Het
Msh6 T A 17: 87,990,789 L1354* probably null Het
Mtmr12 T C 15: 12,230,314 V41A probably damaging Het
Myh2 A T 11: 67,192,725 Q1478L probably benign Het
Myo6 A G 9: 80,288,038 K897E probably benign Het
Naprt G T 15: 75,892,756 probably null Het
Nrl G A 14: 55,522,218 S84L probably benign Het
Nxf1 A G 19: 8,766,764 probably benign Het
Olfr971 A T 9: 39,840,356 R307S possibly damaging Het
Panx2 G T 15: 89,068,220 V305F probably benign Het
Pcdhga1 T C 18: 37,662,579 L212P probably damaging Het
Pik3ap1 G A 19: 41,375,881 T133I probably benign Het
Ppat A G 5: 76,915,214 W517R probably damaging Het
Ppp1r16b C T 2: 158,757,254 T382I probably benign Het
Prkdc A G 16: 15,773,739 K2694E probably damaging Het
Prkdc G A 16: 15,836,082 R3901H probably damaging Het
Psma8 A G 18: 14,721,190 I42M probably damaging Het
Ptprd A T 4: 76,102,963 M599K probably benign Het
Rnmt A G 18: 68,311,671 D237G probably null Het
Rpl31-ps17 C T 12: 54,701,612 noncoding transcript Het
Scaf11 G A 15: 96,418,428 T1085I possibly damaging Het
Sec14l3 G A 11: 4,066,210 R43Q probably damaging Het
Shc4 G T 2: 125,652,522 T131K probably benign Het
Snx27 A G 3: 94,562,023 F4L probably benign Het
Sorcs1 T C 19: 50,378,941 T228A probably damaging Het
Sptan1 C T 2: 30,029,709 probably benign Het
Syvn1 C T 19: 6,049,921 probably benign Het
Tex47 G T 5: 7,305,364 A182S probably benign Het
Thegl T C 5: 77,054,536 I268T possibly damaging Het
Tpcn1 T C 5: 120,542,518 K549R probably damaging Het
Upf3a C A 8: 13,796,573 P318T probably benign Het
Zbtb40 A T 4: 136,998,694 M518K probably damaging Het
Zcchc14 G A 8: 121,651,941 probably benign Het
Zfp687 G A 3: 95,009,128 P861L probably damaging Het
Other mutations in Arid3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00432:Arid3b APN 9 57833924 missense possibly damaging 0.92
IGL01394:Arid3b APN 9 57795034 missense probably damaging 1.00
IGL01950:Arid3b APN 9 57794974 missense probably damaging 1.00
R0970:Arid3b UTSW 9 57833551 intron probably benign
R1848:Arid3b UTSW 9 57796677 nonsense probably null
R1940:Arid3b UTSW 9 57796148 missense possibly damaging 0.86
R4290:Arid3b UTSW 9 57790430 unclassified probably benign
R4293:Arid3b UTSW 9 57790430 unclassified probably benign
R4449:Arid3b UTSW 9 57798121 nonsense probably null
R5353:Arid3b UTSW 9 57795037 splice site probably null
R5544:Arid3b UTSW 9 57798097 nonsense probably null
R6828:Arid3b UTSW 9 57810163 critical splice donor site probably null
R7168:Arid3b UTSW 9 57805535 missense probably benign 0.00
R7254:Arid3b UTSW 9 57796754 missense probably damaging 0.99
R7398:Arid3b UTSW 9 57796212 missense probably benign 0.01
R7882:Arid3b UTSW 9 57796497 missense possibly damaging 0.85
R7891:Arid3b UTSW 9 57810159 missense probably benign 0.00
R8877:Arid3b UTSW 9 57833621 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGCCTTGGAAGCATCTTTGG -3'
(R):5'- GCTACAGATGGATGCCAGAG -3'

Sequencing Primer
(F):5'- CCTTGGAAGCATCTTTGGTATGGTC -3'
(R):5'- GAGAGAATCACAGTTCCTGTATGCC -3'
Posted On2015-07-07