Incidental Mutation 'R4424:Dhrs13'
ID327275
Institutional Source Beutler Lab
Gene Symbol Dhrs13
Ensembl Gene ENSMUSG00000020834
Gene Namedehydrogenase/reductase (SDR family) member 13
Synonyms
MMRRC Submission 041696-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R4424 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location78032280-78037866 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 78037125 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Stop codon at position 266 (G266*)
Ref Sequence ENSEMBL: ENSMUSP00000112553 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021187] [ENSMUST00000072289] [ENSMUST00000073660] [ENSMUST00000092881] [ENSMUST00000100784] [ENSMUST00000122342] [ENSMUST00000144028] [ENSMUST00000148162]
Predicted Effect probably null
Transcript: ENSMUST00000021187
AA Change: G316*
SMART Domains Protein: ENSMUSP00000021187
Gene: ENSMUSG00000020834
AA Change: G316*

DomainStartEndE-ValueType
low complexity region 4 23 N/A INTRINSIC
Pfam:KR 37 176 1.6e-10 PFAM
Pfam:adh_short 37 238 6e-32 PFAM
Pfam:Epimerase 39 256 3.4e-7 PFAM
low complexity region 317 342 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000072289
SMART Domains Protein: ENSMUSP00000072136
Gene: ENSMUSG00000061981

DomainStartEndE-ValueType
PHB 87 269 1.34e-10 SMART
Pfam:Flot 311 422 6.3e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000073660
SMART Domains Protein: ENSMUSP00000073342
Gene: ENSMUSG00000061981

DomainStartEndE-ValueType
PHB 87 269 1.34e-10 SMART
Pfam:Flot 311 422 5.1e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000092881
SMART Domains Protein: ENSMUSP00000090557
Gene: ENSMUSG00000020834

DomainStartEndE-ValueType
low complexity region 4 23 N/A INTRINSIC
Pfam:adh_short 37 111 3.2e-9 PFAM
Pfam:NAD_binding_10 39 116 7.6e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000100784
SMART Domains Protein: ENSMUSP00000098347
Gene: ENSMUSG00000061981

DomainStartEndE-ValueType
PHB 38 220 1.34e-10 SMART
Blast:PHB 277 347 2e-35 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000122342
AA Change: G266*
SMART Domains Protein: ENSMUSP00000112553
Gene: ENSMUSG00000020834
AA Change: G266*

DomainStartEndE-ValueType
Pfam:adh_short 1 131 9.1e-17 PFAM
low complexity region 267 292 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136353
Predicted Effect probably benign
Transcript: ENSMUST00000144028
Predicted Effect probably benign
Transcript: ENSMUST00000148162
SMART Domains Protein: ENSMUSP00000133147
Gene: ENSMUSG00000061981

DomainStartEndE-ValueType
Blast:PHB 2 74 2e-34 BLAST
PDB:1WIN|A 40 74 2e-8 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150471
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 95% (69/73)
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933409G03Rik A T 2: 68,615,147 probably benign Het
Aimp1 A T 3: 132,667,492 L229Q probably benign Het
Ankrd16 T A 2: 11,784,404 D267E possibly damaging Het
Apol11b A G 15: 77,637,933 probably null Het
Arfgap1 C A 2: 180,981,076 D327E probably benign Het
Arid3b A T 9: 57,833,868 D98E probably benign Het
Art2b T A 7: 101,579,922 I257F probably benign Het
Atp5a1 T A 18: 77,780,066 probably benign Het
Carmil3 A G 14: 55,501,471 T861A probably benign Het
Cep164 A T 9: 45,779,704 F1259L possibly damaging Het
Chrnd T C 1: 87,195,790 V350A probably benign Het
Clcn7 T C 17: 25,160,176 L744P probably damaging Het
Csl T A 10: 99,758,591 D204V possibly damaging Het
Cyp2c29 G T 19: 39,287,176 W20L probably damaging Het
Dll3 T C 7: 28,296,291 N362D probably damaging Het
Fanca A G 8: 123,288,793 V715A probably benign Het
Fhod1 T C 8: 105,337,351 probably benign Het
Fpr2 C T 17: 17,893,132 P130L probably damaging Het
Glce A G 9: 62,060,253 Y539H probably damaging Het
Gm11639 T G 11: 104,736,114 probably null Het
Gm4758 A G 16: 36,312,589 D76G probably null Het
Hfe A T 13: 23,706,883 V91E probably benign Het
Hoxd13 A T 2: 74,669,957 K281* probably null Het
Ighv1-66 A T 12: 115,593,537 W3R probably damaging Het
Impg2 G A 16: 56,260,025 V622I possibly damaging Het
Jun A G 4: 95,050,847 M142T probably benign Het
Krt78 T C 15: 101,947,940 T479A probably benign Het
Lama3 T A 18: 12,519,872 C216* probably null Het
Lin54 G T 5: 100,446,560 T582K probably damaging Het
Maats1 G T 16: 38,320,365 P409T probably damaging Het
Mapk11 A G 15: 89,145,373 probably null Het
Mindy3 A G 2: 12,348,199 M397T probably benign Het
Mrpl41 T C 2: 24,974,406 T85A possibly damaging Het
Msh6 T A 17: 87,990,789 L1354* probably null Het
Mtmr12 T C 15: 12,230,314 V41A probably damaging Het
Myh2 A T 11: 67,192,725 Q1478L probably benign Het
Myo6 A G 9: 80,288,038 K897E probably benign Het
Naprt G T 15: 75,892,756 probably null Het
Nrl G A 14: 55,522,218 S84L probably benign Het
Nxf1 A G 19: 8,766,764 probably benign Het
Olfr971 A T 9: 39,840,356 R307S possibly damaging Het
Panx2 G T 15: 89,068,220 V305F probably benign Het
Pcdhga1 T C 18: 37,662,579 L212P probably damaging Het
Pik3ap1 G A 19: 41,375,881 T133I probably benign Het
Ppat A G 5: 76,915,214 W517R probably damaging Het
Ppp1r16b C T 2: 158,757,254 T382I probably benign Het
Prkdc A G 16: 15,773,739 K2694E probably damaging Het
Prkdc G A 16: 15,836,082 R3901H probably damaging Het
Psma8 A G 18: 14,721,190 I42M probably damaging Het
Ptprd A T 4: 76,102,963 M599K probably benign Het
Rnmt A G 18: 68,311,671 D237G probably null Het
Rpl31-ps17 C T 12: 54,701,612 noncoding transcript Het
Scaf11 G A 15: 96,418,428 T1085I possibly damaging Het
Sec14l3 G A 11: 4,066,210 R43Q probably damaging Het
Shc4 G T 2: 125,652,522 T131K probably benign Het
Snx27 A G 3: 94,562,023 F4L probably benign Het
Sorcs1 T C 19: 50,378,941 T228A probably damaging Het
Sptan1 C T 2: 30,029,709 probably benign Het
Syvn1 C T 19: 6,049,921 probably benign Het
Tex47 G T 5: 7,305,364 A182S probably benign Het
Thegl T C 5: 77,054,536 I268T possibly damaging Het
Tpcn1 T C 5: 120,542,518 K549R probably damaging Het
Upf3a C A 8: 13,796,573 P318T probably benign Het
Zbtb40 A T 4: 136,998,694 M518K probably damaging Het
Zcchc14 G A 8: 121,651,941 probably benign Het
Zfp687 G A 3: 95,009,128 P861L probably damaging Het
Other mutations in Dhrs13
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0594:Dhrs13 UTSW 11 78034525 missense probably damaging 0.98
R0684:Dhrs13 UTSW 11 78036963 missense probably damaging 1.00
R0890:Dhrs13 UTSW 11 78034350 missense probably null 1.00
R5038:Dhrs13 UTSW 11 78032430 unclassified probably benign
R6151:Dhrs13 UTSW 11 78036982 missense probably damaging 1.00
R6306:Dhrs13 UTSW 11 78032693 missense probably damaging 0.97
R6765:Dhrs13 UTSW 11 78037139 missense probably benign
R7177:Dhrs13 UTSW 11 78034382 missense probably benign 0.05
R7525:Dhrs13 UTSW 11 78032434 missense unknown
R8210:Dhrs13 UTSW 11 78033476 missense unknown
R8363:Dhrs13 UTSW 11 78034517 missense probably damaging 0.99
R8669:Dhrs13 UTSW 11 78032666 missense possibly damaging 0.86
R8693:Dhrs13 UTSW 11 78032666 missense possibly damaging 0.86
R8714:Dhrs13 UTSW 11 78032666 missense possibly damaging 0.86
R8739:Dhrs13 UTSW 11 78032666 missense possibly damaging 0.86
R8922:Dhrs13 UTSW 11 78032599 missense possibly damaging 0.70
Predicted Primers PCR Primer
(F):5'- ATGGCTGCGTCCTATTTTGC -3'
(R):5'- AAGTTAGGGTGTAGGTTCATCC -3'

Sequencing Primer
(F):5'- GTCCTATTTTGCGCCCACTGG -3'
(R):5'- GTAGGTTCATCCTTCACCTGAATTC -3'
Posted On2015-07-07