Incidental Mutation 'R4424:Mapk11'
ID327286
Institutional Source Beutler Lab
Gene Symbol Mapk11
Ensembl Gene ENSMUSG00000053137
Gene Namemitogen-activated protein kinase 11
SynonymsP38b, p38beta, Prkm11, Sapk2
MMRRC Submission 041696-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4424 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location89142486-89149628 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 89145373 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000086204 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088823] [ENSMUST00000088827]
Predicted Effect probably null
Transcript: ENSMUST00000088823
SMART Domains Protein: ENSMUSP00000086204
Gene: ENSMUSG00000053137

DomainStartEndE-ValueType
S_TKc 24 308 1.67e-84 SMART
low complexity region 313 325 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000088827
SMART Domains Protein: ENSMUSP00000086207
Gene: ENSMUSG00000022610

DomainStartEndE-ValueType
S_TKc 27 311 1.63e-96 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228967
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229193
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230266
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230634
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230734
Meta Mutation Damage Score 0.9594 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 95% (69/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of protein kinases that are involved in the integration of biochemical signals for a wide variety of cellular processes, including cell proliferation, differentiation, transcriptional regulation, and development. The encoded protein can be activated by proinflammatory cytokines and environmental stresses through phosphorylation by mitogen activated protein kinase kinases (MKKs). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit a normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933409G03Rik A T 2: 68,615,147 probably benign Het
Aimp1 A T 3: 132,667,492 L229Q probably benign Het
Ankrd16 T A 2: 11,784,404 D267E possibly damaging Het
Apol11b A G 15: 77,637,933 probably null Het
Arfgap1 C A 2: 180,981,076 D327E probably benign Het
Arid3b A T 9: 57,833,868 D98E probably benign Het
Art2b T A 7: 101,579,922 I257F probably benign Het
Atp5a1 T A 18: 77,780,066 probably benign Het
Carmil3 A G 14: 55,501,471 T861A probably benign Het
Cep164 A T 9: 45,779,704 F1259L possibly damaging Het
Chrnd T C 1: 87,195,790 V350A probably benign Het
Clcn7 T C 17: 25,160,176 L744P probably damaging Het
Csl T A 10: 99,758,591 D204V possibly damaging Het
Cyp2c29 G T 19: 39,287,176 W20L probably damaging Het
Dhrs13 G T 11: 78,037,125 G266* probably null Het
Dll3 T C 7: 28,296,291 N362D probably damaging Het
Fanca A G 8: 123,288,793 V715A probably benign Het
Fhod1 T C 8: 105,337,351 probably benign Het
Fpr2 C T 17: 17,893,132 P130L probably damaging Het
Glce A G 9: 62,060,253 Y539H probably damaging Het
Gm11639 T G 11: 104,736,114 probably null Het
Gm4758 A G 16: 36,312,589 D76G probably null Het
Hfe A T 13: 23,706,883 V91E probably benign Het
Hoxd13 A T 2: 74,669,957 K281* probably null Het
Ighv1-66 A T 12: 115,593,537 W3R probably damaging Het
Impg2 G A 16: 56,260,025 V622I possibly damaging Het
Jun A G 4: 95,050,847 M142T probably benign Het
Krt78 T C 15: 101,947,940 T479A probably benign Het
Lama3 T A 18: 12,519,872 C216* probably null Het
Lin54 G T 5: 100,446,560 T582K probably damaging Het
Maats1 G T 16: 38,320,365 P409T probably damaging Het
Mindy3 A G 2: 12,348,199 M397T probably benign Het
Mrpl41 T C 2: 24,974,406 T85A possibly damaging Het
Msh6 T A 17: 87,990,789 L1354* probably null Het
Mtmr12 T C 15: 12,230,314 V41A probably damaging Het
Myh2 A T 11: 67,192,725 Q1478L probably benign Het
Myo6 A G 9: 80,288,038 K897E probably benign Het
Naprt G T 15: 75,892,756 probably null Het
Nrl G A 14: 55,522,218 S84L probably benign Het
Nxf1 A G 19: 8,766,764 probably benign Het
Olfr971 A T 9: 39,840,356 R307S possibly damaging Het
Panx2 G T 15: 89,068,220 V305F probably benign Het
Pcdhga1 T C 18: 37,662,579 L212P probably damaging Het
Pik3ap1 G A 19: 41,375,881 T133I probably benign Het
Ppat A G 5: 76,915,214 W517R probably damaging Het
Ppp1r16b C T 2: 158,757,254 T382I probably benign Het
Prkdc A G 16: 15,773,739 K2694E probably damaging Het
Prkdc G A 16: 15,836,082 R3901H probably damaging Het
Psma8 A G 18: 14,721,190 I42M probably damaging Het
Ptprd A T 4: 76,102,963 M599K probably benign Het
Rnmt A G 18: 68,311,671 D237G probably null Het
Rpl31-ps17 C T 12: 54,701,612 noncoding transcript Het
Scaf11 G A 15: 96,418,428 T1085I possibly damaging Het
Sec14l3 G A 11: 4,066,210 R43Q probably damaging Het
Shc4 G T 2: 125,652,522 T131K probably benign Het
Snx27 A G 3: 94,562,023 F4L probably benign Het
Sorcs1 T C 19: 50,378,941 T228A probably damaging Het
Sptan1 C T 2: 30,029,709 probably benign Het
Syvn1 C T 19: 6,049,921 probably benign Het
Tex47 G T 5: 7,305,364 A182S probably benign Het
Thegl T C 5: 77,054,536 I268T possibly damaging Het
Tpcn1 T C 5: 120,542,518 K549R probably damaging Het
Upf3a C A 8: 13,796,573 P318T probably benign Het
Zbtb40 A T 4: 136,998,694 M518K probably damaging Het
Zcchc14 G A 8: 121,651,941 probably benign Het
Zfp687 G A 3: 95,009,128 P861L probably damaging Het
Other mutations in Mapk11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01744:Mapk11 APN 15 89146843 splice site probably benign
IGL02164:Mapk11 APN 15 89145448 critical splice acceptor site probably null
IGL02825:Mapk11 APN 15 89146382 missense probably damaging 1.00
E0370:Mapk11 UTSW 15 89146513 missense probably damaging 1.00
R1764:Mapk11 UTSW 15 89144391 critical splice donor site probably null
R2158:Mapk11 UTSW 15 89146372 missense probably damaging 0.98
R3149:Mapk11 UTSW 15 89145450 unclassified probably null
R3150:Mapk11 UTSW 15 89145450 unclassified probably null
R3730:Mapk11 UTSW 15 89145115 missense probably benign 0.27
R4319:Mapk11 UTSW 15 89146743 missense probably damaging 1.00
R4632:Mapk11 UTSW 15 89146376 missense probably damaging 1.00
R4783:Mapk11 UTSW 15 89149488 missense probably damaging 0.98
R4937:Mapk11 UTSW 15 89146482 missense probably benign
R5422:Mapk11 UTSW 15 89146285 missense probably damaging 1.00
R5511:Mapk11 UTSW 15 89145177 critical splice acceptor site probably null
R5914:Mapk11 UTSW 15 89145835 missense probably benign 0.21
R5972:Mapk11 UTSW 15 89144184 missense probably benign 0.34
R7290:Mapk11 UTSW 15 89144308 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTTGCCAGAACCTCAGGAC -3'
(R):5'- TTATGCCTGAGGGTCACTGG -3'

Sequencing Primer
(F):5'- CAGCTGGTCGATGTCTACCTAG -3'
(R):5'- TCACTGGGCTGGCTCCTC -3'
Posted On2015-07-07