Incidental Mutation 'R4424:Impg2'
ID327293
Institutional Source Beutler Lab
Gene Symbol Impg2
Ensembl Gene ENSMUSG00000035270
Gene Nameinterphotoreceptor matrix proteoglycan 2
SynonymsIPM200, Spacrcan, PG10.2
MMRRC Submission 041696-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock #R4424 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location56204313-56273756 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 56260025 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 622 (V622I)
Ref Sequence ENSEMBL: ENSMUSP00000125135 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069936] [ENSMUST00000160116]
Predicted Effect probably benign
Transcript: ENSMUST00000069936
AA Change: V731I

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000063648
Gene: ENSMUSG00000035270
AA Change: V731I

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 66 74 N/A INTRINSIC
low complexity region 207 220 N/A INTRINSIC
SEA 235 345 7.7e-29 SMART
low complexity region 396 407 N/A INTRINSIC
low complexity region 419 444 N/A INTRINSIC
SEA 895 1018 2.18e-28 SMART
EGF_like 1016 1054 3.57e1 SMART
EGF_like 1056 1096 3.04e1 SMART
transmembrane domain 1105 1127 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000160116
AA Change: V622I

PolyPhen 2 Score 0.561 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000125135
Gene: ENSMUSG00000035270
AA Change: V622I

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 66 74 N/A INTRINSIC
low complexity region 207 220 N/A INTRINSIC
SEA 235 345 7.7e-29 SMART
SEA 786 909 2.18e-28 SMART
EGF_like 907 945 3.57e1 SMART
EGF_like 947 987 3.04e1 SMART
transmembrane domain 996 1018 N/A INTRINSIC
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 95% (69/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene binds chondroitin sulfate and hyaluronan and is a proteoglycan. The encoded protein plays a role in the organization of the interphotoreceptor matrix and may promote the growth and maintenance of the light-sensitive photoreceptor outer segment. Defects in this gene are a cause of retinitis pigmentosa type 56 and maculopathy, IMPG2-related.[provided by RefSeq, Mar 2011]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933409G03Rik A T 2: 68,615,147 probably benign Het
Aimp1 A T 3: 132,667,492 L229Q probably benign Het
Ankrd16 T A 2: 11,784,404 D267E possibly damaging Het
Apol11b A G 15: 77,637,933 probably null Het
Arfgap1 C A 2: 180,981,076 D327E probably benign Het
Arid3b A T 9: 57,833,868 D98E probably benign Het
Art2b T A 7: 101,579,922 I257F probably benign Het
Atp5a1 T A 18: 77,780,066 probably benign Het
Carmil3 A G 14: 55,501,471 T861A probably benign Het
Cep164 A T 9: 45,779,704 F1259L possibly damaging Het
Chrnd T C 1: 87,195,790 V350A probably benign Het
Clcn7 T C 17: 25,160,176 L744P probably damaging Het
Csl T A 10: 99,758,591 D204V possibly damaging Het
Cyp2c29 G T 19: 39,287,176 W20L probably damaging Het
Dhrs13 G T 11: 78,037,125 G266* probably null Het
Dll3 T C 7: 28,296,291 N362D probably damaging Het
Fanca A G 8: 123,288,793 V715A probably benign Het
Fhod1 T C 8: 105,337,351 probably benign Het
Fpr2 C T 17: 17,893,132 P130L probably damaging Het
Glce A G 9: 62,060,253 Y539H probably damaging Het
Gm11639 T G 11: 104,736,114 probably null Het
Gm4758 A G 16: 36,312,589 D76G probably null Het
Hfe A T 13: 23,706,883 V91E probably benign Het
Hoxd13 A T 2: 74,669,957 K281* probably null Het
Ighv1-66 A T 12: 115,593,537 W3R probably damaging Het
Jun A G 4: 95,050,847 M142T probably benign Het
Krt78 T C 15: 101,947,940 T479A probably benign Het
Lama3 T A 18: 12,519,872 C216* probably null Het
Lin54 G T 5: 100,446,560 T582K probably damaging Het
Maats1 G T 16: 38,320,365 P409T probably damaging Het
Mapk11 A G 15: 89,145,373 probably null Het
Mindy3 A G 2: 12,348,199 M397T probably benign Het
Mrpl41 T C 2: 24,974,406 T85A possibly damaging Het
Msh6 T A 17: 87,990,789 L1354* probably null Het
Mtmr12 T C 15: 12,230,314 V41A probably damaging Het
Myh2 A T 11: 67,192,725 Q1478L probably benign Het
Myo6 A G 9: 80,288,038 K897E probably benign Het
Naprt G T 15: 75,892,756 probably null Het
Nrl G A 14: 55,522,218 S84L probably benign Het
Nxf1 A G 19: 8,766,764 probably benign Het
Olfr971 A T 9: 39,840,356 R307S possibly damaging Het
Panx2 G T 15: 89,068,220 V305F probably benign Het
Pcdhga1 T C 18: 37,662,579 L212P probably damaging Het
Pik3ap1 G A 19: 41,375,881 T133I probably benign Het
Ppat A G 5: 76,915,214 W517R probably damaging Het
Ppp1r16b C T 2: 158,757,254 T382I probably benign Het
Prkdc A G 16: 15,773,739 K2694E probably damaging Het
Prkdc G A 16: 15,836,082 R3901H probably damaging Het
Psma8 A G 18: 14,721,190 I42M probably damaging Het
Ptprd A T 4: 76,102,963 M599K probably benign Het
Rnmt A G 18: 68,311,671 D237G probably null Het
Rpl31-ps17 C T 12: 54,701,612 noncoding transcript Het
Scaf11 G A 15: 96,418,428 T1085I possibly damaging Het
Sec14l3 G A 11: 4,066,210 R43Q probably damaging Het
Shc4 G T 2: 125,652,522 T131K probably benign Het
Snx27 A G 3: 94,562,023 F4L probably benign Het
Sorcs1 T C 19: 50,378,941 T228A probably damaging Het
Sptan1 C T 2: 30,029,709 probably benign Het
Syvn1 C T 19: 6,049,921 probably benign Het
Tex47 G T 5: 7,305,364 A182S probably benign Het
Thegl T C 5: 77,054,536 I268T possibly damaging Het
Tpcn1 T C 5: 120,542,518 K549R probably damaging Het
Upf3a C A 8: 13,796,573 P318T probably benign Het
Zbtb40 A T 4: 136,998,694 M518K probably damaging Het
Zcchc14 G A 8: 121,651,941 probably benign Het
Zfp687 G A 3: 95,009,128 P861L probably damaging Het
Other mutations in Impg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00542:Impg2 APN 16 56261605 nonsense probably null
IGL01097:Impg2 APN 16 56260647 critical splice donor site probably null
IGL01115:Impg2 APN 16 56259440 missense possibly damaging 0.61
IGL01545:Impg2 APN 16 56225717 splice site probably benign
IGL01644:Impg2 APN 16 56259870 missense probably benign 0.04
IGL01690:Impg2 APN 16 56205205 missense probably damaging 0.97
IGL01781:Impg2 APN 16 56252225 missense probably benign 0.21
IGL01801:Impg2 APN 16 56236748 missense probably damaging 0.97
IGL01980:Impg2 APN 16 56221527 missense probably damaging 0.99
IGL02059:Impg2 APN 16 56259972 missense probably damaging 1.00
IGL02140:Impg2 APN 16 56259468 missense probably benign 0.05
IGL02206:Impg2 APN 16 56259597 missense possibly damaging 0.92
IGL02245:Impg2 APN 16 56269082 missense probably damaging 0.96
IGL02584:Impg2 APN 16 56265011 missense probably damaging 1.00
IGL03061:Impg2 APN 16 56268416 missense probably damaging 1.00
IGL03123:Impg2 APN 16 56267122 missense probably damaging 1.00
IGL03280:Impg2 APN 16 56268268 nonsense probably null
R0051:Impg2 UTSW 16 56258048 missense probably damaging 1.00
R0117:Impg2 UTSW 16 56261642 missense probably damaging 0.99
R0193:Impg2 UTSW 16 56265049 nonsense probably null
R0270:Impg2 UTSW 16 56269015 missense possibly damaging 0.88
R0326:Impg2 UTSW 16 56260485 missense probably damaging 1.00
R0330:Impg2 UTSW 16 56252264 missense probably damaging 0.99
R0812:Impg2 UTSW 16 56257939 intron probably benign
R1074:Impg2 UTSW 16 56265178 splice site probably benign
R1283:Impg2 UTSW 16 56257939 intron probably benign
R1618:Impg2 UTSW 16 56259858 missense probably damaging 0.97
R1708:Impg2 UTSW 16 56265078 missense probably benign 0.10
R1713:Impg2 UTSW 16 56260526 missense probably benign 0.25
R1827:Impg2 UTSW 16 56267220 missense possibly damaging 0.62
R1853:Impg2 UTSW 16 56260277 missense probably damaging 1.00
R2064:Impg2 UTSW 16 56243630 critical splice donor site probably null
R2100:Impg2 UTSW 16 56231385 splice site probably null
R2125:Impg2 UTSW 16 56265064 missense probably damaging 1.00
R2128:Impg2 UTSW 16 56218379 missense probably damaging 1.00
R2195:Impg2 UTSW 16 56260134 missense probably benign 0.39
R2247:Impg2 UTSW 16 56268264 missense probably damaging 0.97
R2366:Impg2 UTSW 16 56259873 missense probably benign 0.04
R2411:Impg2 UTSW 16 56252154 missense probably damaging 1.00
R4193:Impg2 UTSW 16 56268411 missense probably benign 0.00
R4356:Impg2 UTSW 16 56260164 missense probably damaging 1.00
R4575:Impg2 UTSW 16 56261732 missense probably damaging 1.00
R4766:Impg2 UTSW 16 56257939 intron probably benign
R5024:Impg2 UTSW 16 56260100 missense probably damaging 0.97
R5278:Impg2 UTSW 16 56221517 missense probably benign 0.06
R5383:Impg2 UTSW 16 56243626 missense probably benign 0.03
R5766:Impg2 UTSW 16 56259820 missense possibly damaging 0.73
R5909:Impg2 UTSW 16 56258136 missense probably damaging 0.99
R6525:Impg2 UTSW 16 56205149 missense probably damaging 1.00
R6684:Impg2 UTSW 16 56259929 missense probably benign 0.33
R6692:Impg2 UTSW 16 56252333 missense probably damaging 1.00
R6711:Impg2 UTSW 16 56265086 missense probably damaging 1.00
R6909:Impg2 UTSW 16 56204584 missense probably damaging 0.97
R6959:Impg2 UTSW 16 56268330 missense probably benign 0.01
R7226:Impg2 UTSW 16 56267104 nonsense probably null
R7456:Impg2 UTSW 16 56259913 missense probably benign 0.03
R7528:Impg2 UTSW 16 56260380 missense possibly damaging 0.86
R7532:Impg2 UTSW 16 56267180 missense probably damaging 0.96
R7601:Impg2 UTSW 16 56260031 missense probably benign 0.22
R7803:Impg2 UTSW 16 56267150 missense probably damaging 0.99
R8063:Impg2 UTSW 16 56261456 intron probably benign
R8251:Impg2 UTSW 16 56259597 missense possibly damaging 0.92
R8292:Impg2 UTSW 16 56260626 missense probably damaging 1.00
R8481:Impg2 UTSW 16 56252266 missense possibly damaging 0.76
R8524:Impg2 UTSW 16 56218394 missense probably benign 0.03
R8782:Impg2 UTSW 16 56259455 missense probably damaging 0.99
R8795:Impg2 UTSW 16 56260248 missense probably benign 0.25
R8901:Impg2 UTSW 16 56252165 missense probably damaging 1.00
X0023:Impg2 UTSW 16 56259876 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- GGCAGAGTAGATTCCACAGAAC -3'
(R):5'- TCCCTAAGGAAGAAGTTCTTGTC -3'

Sequencing Primer
(F):5'- ATCAGAACATAGATATGGAGATAGGC -3'
(R):5'- CCAAACTGTATCTGATTCTGGCAAC -3'
Posted On2015-07-07