Incidental Mutation 'R4424:Clcn7'
ID 327295
Institutional Source Beutler Lab
Gene Symbol Clcn7
Ensembl Gene ENSMUSG00000036636
Gene Name chloride channel, voltage-sensitive 7
Synonyms ClC-7
MMRRC Submission 041696-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4424 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 25352365-25381078 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 25379150 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 744 (L744P)
Ref Sequence ENSEMBL: ENSMUSP00000124194 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040729] [ENSMUST00000073277] [ENSMUST00000160961] [ENSMUST00000182292] [ENSMUST00000182621] [ENSMUST00000183178]
AlphaFold O70496
Predicted Effect probably damaging
Transcript: ENSMUST00000040729
AA Change: L764P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000035964
Gene: ENSMUSG00000036636
AA Change: L764P

DomainStartEndE-ValueType
low complexity region 60 74 N/A INTRINSIC
Pfam:Voltage_CLC 183 594 1.5e-96 PFAM
CBS 632 687 8.38e-4 SMART
CBS 742 790 1.77e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000073277
SMART Domains Protein: ENSMUSP00000073002
Gene: ENSMUSG00000059562

DomainStartEndE-ValueType
low complexity region 17 33 N/A INTRINSIC
Pfam:DUF4631 48 578 1.4e-263 PFAM
low complexity region 631 642 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159426
Predicted Effect probably damaging
Transcript: ENSMUST00000160961
AA Change: L744P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124194
Gene: ENSMUSG00000036636
AA Change: L744P

DomainStartEndE-ValueType
low complexity region 8 25 N/A INTRINSIC
low complexity region 40 54 N/A INTRINSIC
Pfam:Voltage_CLC 163 574 1.5e-93 PFAM
CBS 612 667 8.38e-4 SMART
CBS 722 770 1.77e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162862
SMART Domains Protein: ENSMUSP00000124527
Gene: ENSMUSG00000036636

DomainStartEndE-ValueType
Pfam:Voltage_CLC 5 307 1.3e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000182292
SMART Domains Protein: ENSMUSP00000138191
Gene: ENSMUSG00000059562

DomainStartEndE-ValueType
low complexity region 17 33 N/A INTRINSIC
Pfam:DUF4631 47 571 1.3e-250 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000182621
SMART Domains Protein: ENSMUSP00000138090
Gene: ENSMUSG00000059562

DomainStartEndE-ValueType
low complexity region 17 33 N/A INTRINSIC
Pfam:DUF4631 47 573 2.9e-252 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000183178
SMART Domains Protein: ENSMUSP00000138659
Gene: ENSMUSG00000059562

DomainStartEndE-ValueType
low complexity region 17 33 N/A INTRINSIC
Meta Mutation Damage Score 0.9628 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 95% (69/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the CLC chloride channel family of proteins. Chloride channels play important roles in the plasma membrane and in intracellular organelles. This gene encodes chloride channel 7. Defects in this gene are the cause of osteopetrosis autosomal recessive type 4 (OPTB4), also called infantile malignant osteopetrosis type 2 as well as the cause of autosomal dominant osteopetrosis type 2 (OPTA2), also called autosomal dominant Albers-Schonberg disease or marble disease autosoml dominant. Osteopetrosis is a rare genetic disease characterized by abnormally dense bone, due to defective resorption of immature bone. OPTA2 is the most common form of osteopetrosis, occurring in adolescence or adulthood. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit postnatal lethality, abnormal bone formation, including osteopetrosis, and retinal degeneration. Mice homozygous for a conditional allele exhibit lysosomal defects with neuronal degeneration and accumulationof giant lysosomes in renal tubule cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933409G03Rik A T 2: 68,445,491 (GRCm39) probably benign Het
Aimp1 A T 3: 132,373,253 (GRCm39) L229Q probably benign Het
Ankrd16 T A 2: 11,789,215 (GRCm39) D267E possibly damaging Het
Apol11b A G 15: 77,522,133 (GRCm39) probably null Het
Arfgap1 C A 2: 180,622,869 (GRCm39) D327E probably benign Het
Arid3b A T 9: 57,741,151 (GRCm39) D98E probably benign Het
Art2b T A 7: 101,229,129 (GRCm39) I257F probably benign Het
Atp5f1a T A 18: 77,867,766 (GRCm39) probably benign Het
Carmil3 A G 14: 55,738,928 (GRCm39) T861A probably benign Het
Cep164 A T 9: 45,691,002 (GRCm39) F1259L possibly damaging Het
Cfap91 G T 16: 38,140,727 (GRCm39) P409T probably damaging Het
Chrnd T C 1: 87,123,512 (GRCm39) V350A probably benign Het
Csl T A 10: 99,594,453 (GRCm39) D204V possibly damaging Het
Cstdc3 A G 16: 36,132,951 (GRCm39) D76G probably null Het
Cyp2c29 G T 19: 39,275,620 (GRCm39) W20L probably damaging Het
Dhrs13 G T 11: 77,927,951 (GRCm39) G266* probably null Het
Dll3 T C 7: 27,995,716 (GRCm39) N362D probably damaging Het
Efcab3 T G 11: 104,626,940 (GRCm39) probably null Het
Fanca A G 8: 124,015,532 (GRCm39) V715A probably benign Het
Fhod1 T C 8: 106,063,983 (GRCm39) probably benign Het
Fpr2 C T 17: 18,113,394 (GRCm39) P130L probably damaging Het
Glce A G 9: 61,967,535 (GRCm39) Y539H probably damaging Het
Hfe A T 13: 23,890,866 (GRCm39) V91E probably benign Het
Hoxd13 A T 2: 74,500,301 (GRCm39) K281* probably null Het
Ighv1-66 A T 12: 115,557,157 (GRCm39) W3R probably damaging Het
Impg2 G A 16: 56,080,388 (GRCm39) V622I possibly damaging Het
Jun A G 4: 94,939,084 (GRCm39) M142T probably benign Het
Krt78 T C 15: 101,856,375 (GRCm39) T479A probably benign Het
Lama3 T A 18: 12,652,929 (GRCm39) C216* probably null Het
Lin54 G T 5: 100,594,419 (GRCm39) T582K probably damaging Het
Mapk11 A G 15: 89,029,576 (GRCm39) probably null Het
Mindy3 A G 2: 12,353,010 (GRCm39) M397T probably benign Het
Mrpl41 T C 2: 24,864,418 (GRCm39) T85A possibly damaging Het
Msh6 T A 17: 88,298,217 (GRCm39) L1354* probably null Het
Mtmr12 T C 15: 12,230,400 (GRCm39) V41A probably damaging Het
Myh2 A T 11: 67,083,551 (GRCm39) Q1478L probably benign Het
Myo6 A G 9: 80,195,320 (GRCm39) K897E probably benign Het
Naprt G T 15: 75,764,605 (GRCm39) probably null Het
Nrl G A 14: 55,759,675 (GRCm39) S84L probably benign Het
Nxf1 A G 19: 8,744,128 (GRCm39) probably benign Het
Or8g2b A T 9: 39,751,652 (GRCm39) R307S possibly damaging Het
Panx2 G T 15: 88,952,423 (GRCm39) V305F probably benign Het
Pcdhga1 T C 18: 37,795,632 (GRCm39) L212P probably damaging Het
Pik3ap1 G A 19: 41,364,320 (GRCm39) T133I probably benign Het
Ppat A G 5: 77,063,061 (GRCm39) W517R probably damaging Het
Ppp1r16b C T 2: 158,599,174 (GRCm39) T382I probably benign Het
Prkdc G A 16: 15,653,946 (GRCm39) R3901H probably damaging Het
Prkdc A G 16: 15,591,603 (GRCm39) K2694E probably damaging Het
Psma8 A G 18: 14,854,247 (GRCm39) I42M probably damaging Het
Ptprd A T 4: 76,021,200 (GRCm39) M599K probably benign Het
Rnmt A G 18: 68,444,742 (GRCm39) D237G probably null Het
Rpl31-ps17 C T 12: 54,748,397 (GRCm39) noncoding transcript Het
Scaf11 G A 15: 96,316,309 (GRCm39) T1085I possibly damaging Het
Sec14l3 G A 11: 4,016,210 (GRCm39) R43Q probably damaging Het
Shc4 G T 2: 125,494,442 (GRCm39) T131K probably benign Het
Snx27 A G 3: 94,469,330 (GRCm39) F4L probably benign Het
Sorcs1 T C 19: 50,367,379 (GRCm39) T228A probably damaging Het
Spmap2l T C 5: 77,202,383 (GRCm39) I268T possibly damaging Het
Sptan1 C T 2: 29,919,721 (GRCm39) probably benign Het
Syvn1 C T 19: 6,099,951 (GRCm39) probably benign Het
Tex47 G T 5: 7,355,364 (GRCm39) A182S probably benign Het
Tpcn1 T C 5: 120,680,583 (GRCm39) K549R probably damaging Het
Upf3a C A 8: 13,846,573 (GRCm39) P318T probably benign Het
Zbtb40 A T 4: 136,726,005 (GRCm39) M518K probably damaging Het
Zcchc14 G A 8: 122,378,680 (GRCm39) probably benign Het
Zfp687 G A 3: 94,916,439 (GRCm39) P861L probably damaging Het
Other mutations in Clcn7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00486:Clcn7 APN 17 25,370,097 (GRCm39) missense probably damaging 1.00
IGL01735:Clcn7 APN 17 25,370,090 (GRCm39) missense probably benign 0.13
IGL01912:Clcn7 APN 17 25,371,983 (GRCm39) splice site probably benign
IGL01936:Clcn7 APN 17 25,374,350 (GRCm39) missense probably benign 0.44
IGL02084:Clcn7 APN 17 25,376,899 (GRCm39) missense probably benign
IGL02121:Clcn7 APN 17 25,372,058 (GRCm39) missense possibly damaging 0.95
IGL02160:Clcn7 APN 17 25,368,004 (GRCm39) unclassified probably benign
IGL02335:Clcn7 APN 17 25,365,821 (GRCm39) missense probably benign 0.00
IGL02507:Clcn7 APN 17 25,363,443 (GRCm39) missense probably damaging 1.00
IGL02605:Clcn7 APN 17 25,365,792 (GRCm39) missense possibly damaging 0.60
IGL03160:Clcn7 APN 17 25,365,427 (GRCm39) unclassified probably benign
IGL03192:Clcn7 APN 17 25,352,575 (GRCm39) missense probably benign 0.00
IGL03194:Clcn7 APN 17 25,369,522 (GRCm39) missense probably damaging 0.98
IGL03409:Clcn7 APN 17 25,374,359 (GRCm39) missense probably damaging 1.00
R0140:Clcn7 UTSW 17 25,372,728 (GRCm39) missense probably damaging 1.00
R0153:Clcn7 UTSW 17 25,368,176 (GRCm39) unclassified probably benign
R0970:Clcn7 UTSW 17 25,370,208 (GRCm39) critical splice donor site probably null
R1644:Clcn7 UTSW 17 25,378,672 (GRCm39) missense probably damaging 1.00
R1856:Clcn7 UTSW 17 25,379,445 (GRCm39) missense probably damaging 1.00
R2145:Clcn7 UTSW 17 25,363,425 (GRCm39) missense probably benign
R2173:Clcn7 UTSW 17 25,364,583 (GRCm39) missense probably benign
R2401:Clcn7 UTSW 17 25,372,114 (GRCm39) missense probably benign 0.02
R2511:Clcn7 UTSW 17 25,374,420 (GRCm39) missense probably damaging 1.00
R3683:Clcn7 UTSW 17 25,369,567 (GRCm39) missense possibly damaging 0.84
R3684:Clcn7 UTSW 17 25,369,567 (GRCm39) missense possibly damaging 0.84
R3694:Clcn7 UTSW 17 25,378,681 (GRCm39) missense probably damaging 0.99
R4681:Clcn7 UTSW 17 25,376,935 (GRCm39) missense probably damaging 1.00
R4870:Clcn7 UTSW 17 25,372,539 (GRCm39) intron probably benign
R5372:Clcn7 UTSW 17 25,376,153 (GRCm39) missense possibly damaging 0.82
R5820:Clcn7 UTSW 17 25,368,026 (GRCm39) missense probably damaging 1.00
R6154:Clcn7 UTSW 17 25,376,928 (GRCm39) missense probably damaging 0.98
R6181:Clcn7 UTSW 17 25,370,702 (GRCm39) missense possibly damaging 0.79
R6306:Clcn7 UTSW 17 25,376,502 (GRCm39) missense probably benign 0.01
R6798:Clcn7 UTSW 17 25,378,734 (GRCm39) missense probably damaging 1.00
R6961:Clcn7 UTSW 17 25,376,188 (GRCm39) missense probably damaging 1.00
R7020:Clcn7 UTSW 17 25,365,325 (GRCm39) missense possibly damaging 0.76
R7089:Clcn7 UTSW 17 25,372,667 (GRCm39) missense
R7757:Clcn7 UTSW 17 25,375,796 (GRCm39) missense probably damaging 1.00
R8057:Clcn7 UTSW 17 25,368,233 (GRCm39) nonsense probably null
R8670:Clcn7 UTSW 17 25,378,588 (GRCm39) missense probably damaging 0.99
R9031:Clcn7 UTSW 17 25,376,497 (GRCm39) missense probably damaging 0.96
R9720:Clcn7 UTSW 17 25,374,471 (GRCm39) missense probably damaging 1.00
X0020:Clcn7 UTSW 17 25,369,200 (GRCm39) missense probably damaging 1.00
Z1177:Clcn7 UTSW 17 25,371,989 (GRCm39) critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TGAGGTGGCCATCTAACCAG -3'
(R):5'- AGTAATAGGCTAGGACCCAGGC -3'

Sequencing Primer
(F):5'- TAGCATTACACAGGTCCTTAGAGTC -3'
(R):5'- TAGGACCCAGGCTTACTGTC -3'
Posted On 2015-07-07