Incidental Mutation 'R4424:Clcn7'
ID327295
Institutional Source Beutler Lab
Gene Symbol Clcn7
Ensembl Gene ENSMUSG00000036636
Gene Namechloride channel, voltage-sensitive 7
SynonymsClC-7
MMRRC Submission 041696-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4424 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location25133391-25162104 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 25160176 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 744 (L744P)
Ref Sequence ENSEMBL: ENSMUSP00000124194 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040729] [ENSMUST00000073277] [ENSMUST00000160961] [ENSMUST00000182292] [ENSMUST00000182621] [ENSMUST00000183178]
Predicted Effect probably damaging
Transcript: ENSMUST00000040729
AA Change: L764P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000035964
Gene: ENSMUSG00000036636
AA Change: L764P

DomainStartEndE-ValueType
low complexity region 60 74 N/A INTRINSIC
Pfam:Voltage_CLC 183 594 1.5e-96 PFAM
CBS 632 687 8.38e-4 SMART
CBS 742 790 1.77e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000073277
SMART Domains Protein: ENSMUSP00000073002
Gene: ENSMUSG00000059562

DomainStartEndE-ValueType
low complexity region 17 33 N/A INTRINSIC
Pfam:DUF4631 48 578 1.4e-263 PFAM
low complexity region 631 642 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159426
Predicted Effect probably damaging
Transcript: ENSMUST00000160961
AA Change: L744P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124194
Gene: ENSMUSG00000036636
AA Change: L744P

DomainStartEndE-ValueType
low complexity region 8 25 N/A INTRINSIC
low complexity region 40 54 N/A INTRINSIC
Pfam:Voltage_CLC 163 574 1.5e-93 PFAM
CBS 612 667 8.38e-4 SMART
CBS 722 770 1.77e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162862
SMART Domains Protein: ENSMUSP00000124527
Gene: ENSMUSG00000036636

DomainStartEndE-ValueType
Pfam:Voltage_CLC 5 307 1.3e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000182292
SMART Domains Protein: ENSMUSP00000138191
Gene: ENSMUSG00000059562

DomainStartEndE-ValueType
low complexity region 17 33 N/A INTRINSIC
Pfam:DUF4631 47 571 1.3e-250 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000182621
SMART Domains Protein: ENSMUSP00000138090
Gene: ENSMUSG00000059562

DomainStartEndE-ValueType
low complexity region 17 33 N/A INTRINSIC
Pfam:DUF4631 47 573 2.9e-252 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000183178
SMART Domains Protein: ENSMUSP00000138659
Gene: ENSMUSG00000059562

DomainStartEndE-ValueType
low complexity region 17 33 N/A INTRINSIC
Meta Mutation Damage Score 0.9628 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 95% (69/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the CLC chloride channel family of proteins. Chloride channels play important roles in the plasma membrane and in intracellular organelles. This gene encodes chloride channel 7. Defects in this gene are the cause of osteopetrosis autosomal recessive type 4 (OPTB4), also called infantile malignant osteopetrosis type 2 as well as the cause of autosomal dominant osteopetrosis type 2 (OPTA2), also called autosomal dominant Albers-Schonberg disease or marble disease autosoml dominant. Osteopetrosis is a rare genetic disease characterized by abnormally dense bone, due to defective resorption of immature bone. OPTA2 is the most common form of osteopetrosis, occurring in adolescence or adulthood. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit postnatal lethality, abnormal bone formation, including osteopetrosis, and retinal degeneration. Mice homozygous for a conditional allele exhibit lysosomal defects with neuronal degeneration and accumulationof giant lysosomes in renal tubule cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933409G03Rik A T 2: 68,615,147 probably benign Het
Aimp1 A T 3: 132,667,492 L229Q probably benign Het
Ankrd16 T A 2: 11,784,404 D267E possibly damaging Het
Apol11b A G 15: 77,637,933 probably null Het
Arfgap1 C A 2: 180,981,076 D327E probably benign Het
Arid3b A T 9: 57,833,868 D98E probably benign Het
Art2b T A 7: 101,579,922 I257F probably benign Het
Atp5a1 T A 18: 77,780,066 probably benign Het
Carmil3 A G 14: 55,501,471 T861A probably benign Het
Cep164 A T 9: 45,779,704 F1259L possibly damaging Het
Chrnd T C 1: 87,195,790 V350A probably benign Het
Csl T A 10: 99,758,591 D204V possibly damaging Het
Cyp2c29 G T 19: 39,287,176 W20L probably damaging Het
Dhrs13 G T 11: 78,037,125 G266* probably null Het
Dll3 T C 7: 28,296,291 N362D probably damaging Het
Fanca A G 8: 123,288,793 V715A probably benign Het
Fhod1 T C 8: 105,337,351 probably benign Het
Fpr2 C T 17: 17,893,132 P130L probably damaging Het
Glce A G 9: 62,060,253 Y539H probably damaging Het
Gm11639 T G 11: 104,736,114 probably null Het
Gm4758 A G 16: 36,312,589 D76G probably null Het
Hfe A T 13: 23,706,883 V91E probably benign Het
Hoxd13 A T 2: 74,669,957 K281* probably null Het
Ighv1-66 A T 12: 115,593,537 W3R probably damaging Het
Impg2 G A 16: 56,260,025 V622I possibly damaging Het
Jun A G 4: 95,050,847 M142T probably benign Het
Krt78 T C 15: 101,947,940 T479A probably benign Het
Lama3 T A 18: 12,519,872 C216* probably null Het
Lin54 G T 5: 100,446,560 T582K probably damaging Het
Maats1 G T 16: 38,320,365 P409T probably damaging Het
Mapk11 A G 15: 89,145,373 probably null Het
Mindy3 A G 2: 12,348,199 M397T probably benign Het
Mrpl41 T C 2: 24,974,406 T85A possibly damaging Het
Msh6 T A 17: 87,990,789 L1354* probably null Het
Mtmr12 T C 15: 12,230,314 V41A probably damaging Het
Myh2 A T 11: 67,192,725 Q1478L probably benign Het
Myo6 A G 9: 80,288,038 K897E probably benign Het
Naprt G T 15: 75,892,756 probably null Het
Nrl G A 14: 55,522,218 S84L probably benign Het
Nxf1 A G 19: 8,766,764 probably benign Het
Olfr971 A T 9: 39,840,356 R307S possibly damaging Het
Panx2 G T 15: 89,068,220 V305F probably benign Het
Pcdhga1 T C 18: 37,662,579 L212P probably damaging Het
Pik3ap1 G A 19: 41,375,881 T133I probably benign Het
Ppat A G 5: 76,915,214 W517R probably damaging Het
Ppp1r16b C T 2: 158,757,254 T382I probably benign Het
Prkdc A G 16: 15,773,739 K2694E probably damaging Het
Prkdc G A 16: 15,836,082 R3901H probably damaging Het
Psma8 A G 18: 14,721,190 I42M probably damaging Het
Ptprd A T 4: 76,102,963 M599K probably benign Het
Rnmt A G 18: 68,311,671 D237G probably null Het
Rpl31-ps17 C T 12: 54,701,612 noncoding transcript Het
Scaf11 G A 15: 96,418,428 T1085I possibly damaging Het
Sec14l3 G A 11: 4,066,210 R43Q probably damaging Het
Shc4 G T 2: 125,652,522 T131K probably benign Het
Snx27 A G 3: 94,562,023 F4L probably benign Het
Sorcs1 T C 19: 50,378,941 T228A probably damaging Het
Sptan1 C T 2: 30,029,709 probably benign Het
Syvn1 C T 19: 6,049,921 probably benign Het
Tex47 G T 5: 7,305,364 A182S probably benign Het
Thegl T C 5: 77,054,536 I268T possibly damaging Het
Tpcn1 T C 5: 120,542,518 K549R probably damaging Het
Upf3a C A 8: 13,796,573 P318T probably benign Het
Zbtb40 A T 4: 136,998,694 M518K probably damaging Het
Zcchc14 G A 8: 121,651,941 probably benign Het
Zfp687 G A 3: 95,009,128 P861L probably damaging Het
Other mutations in Clcn7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00486:Clcn7 APN 17 25151123 missense probably damaging 1.00
IGL01735:Clcn7 APN 17 25151116 missense probably benign 0.13
IGL01912:Clcn7 APN 17 25153009 splice site probably benign
IGL01936:Clcn7 APN 17 25155376 missense probably benign 0.44
IGL02084:Clcn7 APN 17 25157925 missense probably benign
IGL02121:Clcn7 APN 17 25153084 missense possibly damaging 0.95
IGL02160:Clcn7 APN 17 25149030 unclassified probably benign
IGL02335:Clcn7 APN 17 25146847 missense probably benign 0.00
IGL02507:Clcn7 APN 17 25144469 missense probably damaging 1.00
IGL02605:Clcn7 APN 17 25146818 missense possibly damaging 0.60
IGL03160:Clcn7 APN 17 25146453 unclassified probably benign
IGL03192:Clcn7 APN 17 25133601 missense probably benign 0.00
IGL03194:Clcn7 APN 17 25150548 missense probably damaging 0.98
IGL03409:Clcn7 APN 17 25155385 missense probably damaging 1.00
R0140:Clcn7 UTSW 17 25153754 missense probably damaging 1.00
R0153:Clcn7 UTSW 17 25149202 unclassified probably benign
R0970:Clcn7 UTSW 17 25151234 critical splice donor site probably null
R1644:Clcn7 UTSW 17 25159698 missense probably damaging 1.00
R1856:Clcn7 UTSW 17 25160471 missense probably damaging 1.00
R2145:Clcn7 UTSW 17 25144451 missense probably benign
R2173:Clcn7 UTSW 17 25145609 missense probably benign
R2401:Clcn7 UTSW 17 25153140 missense probably benign 0.02
R2511:Clcn7 UTSW 17 25155446 missense probably damaging 1.00
R3683:Clcn7 UTSW 17 25150593 missense possibly damaging 0.84
R3684:Clcn7 UTSW 17 25150593 missense possibly damaging 0.84
R3694:Clcn7 UTSW 17 25159707 missense probably damaging 0.99
R4681:Clcn7 UTSW 17 25157961 missense probably damaging 1.00
R4870:Clcn7 UTSW 17 25153565 intron probably benign
R5372:Clcn7 UTSW 17 25157179 missense possibly damaging 0.82
R5820:Clcn7 UTSW 17 25149052 missense probably damaging 1.00
R6154:Clcn7 UTSW 17 25157954 missense probably damaging 0.98
R6181:Clcn7 UTSW 17 25151728 missense possibly damaging 0.79
R6306:Clcn7 UTSW 17 25157528 missense probably benign 0.01
R6798:Clcn7 UTSW 17 25159760 missense probably damaging 1.00
R6961:Clcn7 UTSW 17 25157214 missense probably damaging 1.00
R7020:Clcn7 UTSW 17 25146351 missense possibly damaging 0.76
R7089:Clcn7 UTSW 17 25153693 missense
R7757:Clcn7 UTSW 17 25156822 missense probably damaging 1.00
R8057:Clcn7 UTSW 17 25149259 nonsense probably null
X0020:Clcn7 UTSW 17 25150226 missense probably damaging 1.00
Z1177:Clcn7 UTSW 17 25153015 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TGAGGTGGCCATCTAACCAG -3'
(R):5'- AGTAATAGGCTAGGACCCAGGC -3'

Sequencing Primer
(F):5'- TAGCATTACACAGGTCCTTAGAGTC -3'
(R):5'- TAGGACCCAGGCTTACTGTC -3'
Posted On2015-07-07