Mutagenetix > Incidental Mutations

Incidental Mutation 'R4424:Clcn7'

327295

Institutional Source

Beutler Lab

Gene Symbol

Clcn7

Ensembl Gene

ENSMUSG00000036636

Gene Name

chloride channel, voltage-sensitive 7

Synonyms

ClC-7

MMRRC Submission

041696-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4424 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

25133391-25162104 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 25160176 bp

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 744 (L744P)

Ref Sequence

ENSEMBL: ENSMUSP00000124194 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000040729] [ENSMUST00000073277] [ENSMUST00000160961] [ENSMUST00000182292] [ENSMUST00000182621] [ENSMUST00000183178]

Predicted Effect

probably damaging
Transcript: ENSMUST00000040729
AA Change: L764P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000035964
Gene: ENSMUSG00000036636
AA Change: L764P

Domain	Start	End	E-Value	Type
low complexity region	60	74	N/A	INTRINSIC
Pfam:Voltage_CLC	183	594	1.5e-96	PFAM
CBS	632	687	8.38e-4	SMART
CBS	742	790	1.77e-11	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000073277

SMART Domains

Protein: ENSMUSP00000073002
Gene: ENSMUSG00000059562

Domain	Start	End	E-Value	Type
low complexity region	17	33	N/A	INTRINSIC
Pfam:DUF4631	48	578	1.4e-263	PFAM
low complexity region	631	642	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159426

Predicted Effect

probably damaging
Transcript: ENSMUST00000160961
AA Change: L744P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000124194
Gene: ENSMUSG00000036636
AA Change: L744P

Domain	Start	End	E-Value	Type
low complexity region	8	25	N/A	INTRINSIC
low complexity region	40	54	N/A	INTRINSIC
Pfam:Voltage_CLC	163	574	1.5e-93	PFAM
CBS	612	667	8.38e-4	SMART
CBS	722	770	1.77e-11	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000162862

SMART Domains

Protein: ENSMUSP00000124527
Gene: ENSMUSG00000036636

Domain	Start	End	E-Value	Type
Pfam:Voltage_CLC	5	307	1.3e-48	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000182292

SMART Domains

Protein: ENSMUSP00000138191
Gene: ENSMUSG00000059562

Domain	Start	End	E-Value	Type
low complexity region	17	33	N/A	INTRINSIC
Pfam:DUF4631	47	571	1.3e-250	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000182621

SMART Domains

Protein: ENSMUSP00000138090
Gene: ENSMUSG00000059562

Domain	Start	End	E-Value	Type
low complexity region	17	33	N/A	INTRINSIC
Pfam:DUF4631	47	573	2.9e-252	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000183178

SMART Domains

Protein: ENSMUSP00000138659
Gene: ENSMUSG00000059562

Domain	Start	End	E-Value	Type
low complexity region	17	33	N/A	INTRINSIC

Meta Mutation Damage Score

0.9628

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.3%

Validation Efficiency

95% (69/73)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the CLC chloride channel family of proteins. Chloride channels play important roles in the plasma membrane and in intracellular organelles. This gene encodes chloride channel 7. Defects in this gene are the cause of osteopetrosis autosomal recessive type 4 (OPTB4), also called infantile malignant osteopetrosis type 2 as well as the cause of autosomal dominant osteopetrosis type 2 (OPTA2), also called autosomal dominant Albers-Schonberg disease or marble disease autosoml dominant. Osteopetrosis is a rare genetic disease characterized by abnormally dense bone, due to defective resorption of immature bone. OPTA2 is the most common form of osteopetrosis, occurring in adolescence or adulthood. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit postnatal lethality, abnormal bone formation, including osteopetrosis, and retinal degeneration. Mice homozygous for a conditional allele exhibit lysosomal defects with neuronal degeneration and accumulationof giant lysosomes in renal tubule cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933409G03Rik	A	T	2: 68,615,147		probably benign	Het
Aimp1	A	T	3: 132,667,492	L229Q	probably benign	Het
Ankrd16	T	A	2: 11,784,404	D267E	possibly damaging	Het
Apol11b	A	G	15: 77,637,933		probably null	Het
Arfgap1	C	A	2: 180,981,076	D327E	probably benign	Het
Arid3b	A	T	9: 57,833,868	D98E	probably benign	Het
Art2b	T	A	7: 101,579,922	I257F	probably benign	Het
Atp5a1	T	A	18: 77,780,066		probably benign	Het
Carmil3	A	G	14: 55,501,471	T861A	probably benign	Het
Cep164	A	T	9: 45,779,704	F1259L	possibly damaging	Het
Chrnd	T	C	1: 87,195,790	V350A	probably benign	Het
Csl	T	A	10: 99,758,591	D204V	possibly damaging	Het
Cyp2c29	G	T	19: 39,287,176	W20L	probably damaging	Het
Dhrs13	G	T	11: 78,037,125	G266*	probably null	Het
Dll3	T	C	7: 28,296,291	N362D	probably damaging	Het
Fanca	A	G	8: 123,288,793	V715A	probably benign	Het
Fhod1	T	C	8: 105,337,351		probably benign	Het
Fpr2	C	T	17: 17,893,132	P130L	probably damaging	Het
Glce	A	G	9: 62,060,253	Y539H	probably damaging	Het
Gm11639	T	G	11: 104,736,114		probably null	Het
Gm4758	A	G	16: 36,312,589	D76G	probably null	Het
Hfe	A	T	13: 23,706,883	V91E	probably benign	Het
Hoxd13	A	T	2: 74,669,957	K281*	probably null	Het
Ighv1-66	A	T	12: 115,593,537	W3R	probably damaging	Het
Impg2	G	A	16: 56,260,025	V622I	possibly damaging	Het
Jun	A	G	4: 95,050,847	M142T	probably benign	Het
Krt78	T	C	15: 101,947,940	T479A	probably benign	Het
Lama3	T	A	18: 12,519,872	C216*	probably null	Het
Lin54	G	T	5: 100,446,560	T582K	probably damaging	Het
Maats1	G	T	16: 38,320,365	P409T	probably damaging	Het
Mapk11	A	G	15: 89,145,373		probably null	Het
Mindy3	A	G	2: 12,348,199	M397T	probably benign	Het
Mrpl41	T	C	2: 24,974,406	T85A	possibly damaging	Het
Msh6	T	A	17: 87,990,789	L1354*	probably null	Het
Mtmr12	T	C	15: 12,230,314	V41A	probably damaging	Het
Myh2	A	T	11: 67,192,725	Q1478L	probably benign	Het
Myo6	A	G	9: 80,288,038	K897E	probably benign	Het
Naprt	G	T	15: 75,892,756		probably null	Het
Nrl	G	A	14: 55,522,218	S84L	probably benign	Het
Nxf1	A	G	19: 8,766,764		probably benign	Het
Olfr971	A	T	9: 39,840,356	R307S	possibly damaging	Het
Panx2	G	T	15: 89,068,220	V305F	probably benign	Het
Pcdhga1	T	C	18: 37,662,579	L212P	probably damaging	Het
Pik3ap1	G	A	19: 41,375,881	T133I	probably benign	Het
Ppat	A	G	5: 76,915,214	W517R	probably damaging	Het
Ppp1r16b	C	T	2: 158,757,254	T382I	probably benign	Het
Prkdc	A	G	16: 15,773,739	K2694E	probably damaging	Het
Prkdc	G	A	16: 15,836,082	R3901H	probably damaging	Het
Psma8	A	G	18: 14,721,190	I42M	probably damaging	Het
Ptprd	A	T	4: 76,102,963	M599K	probably benign	Het
Rnmt	A	G	18: 68,311,671	D237G	probably null	Het
Rpl31-ps17	C	T	12: 54,701,612		noncoding transcript	Het
Scaf11	G	A	15: 96,418,428	T1085I	possibly damaging	Het
Sec14l3	G	A	11: 4,066,210	R43Q	probably damaging	Het
Shc4	G	T	2: 125,652,522	T131K	probably benign	Het
Snx27	A	G	3: 94,562,023	F4L	probably benign	Het
Sorcs1	T	C	19: 50,378,941	T228A	probably damaging	Het
Sptan1	C	T	2: 30,029,709		probably benign	Het
Syvn1	C	T	19: 6,049,921		probably benign	Het
Tex47	G	T	5: 7,305,364	A182S	probably benign	Het
Thegl	T	C	5: 77,054,536	I268T	possibly damaging	Het
Tpcn1	T	C	5: 120,542,518	K549R	probably damaging	Het
Upf3a	C	A	8: 13,796,573	P318T	probably benign	Het
Zbtb40	A	T	4: 136,998,694	M518K	probably damaging	Het
Zcchc14	G	A	8: 121,651,941		probably benign	Het
Zfp687	G	A	3: 95,009,128	P861L	probably damaging	Het

Other mutations in Clcn7

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00486:Clcn7	APN	17	25151123	missense	probably damaging	1.00
IGL01735:Clcn7	APN	17	25151116	missense	probably benign	0.13
IGL01912:Clcn7	APN	17	25153009	splice site	probably benign
IGL01936:Clcn7	APN	17	25155376	missense	probably benign	0.44
IGL02084:Clcn7	APN	17	25157925	missense	probably benign
IGL02121:Clcn7	APN	17	25153084	missense	possibly damaging	0.95
IGL02160:Clcn7	APN	17	25149030	unclassified	probably benign
IGL02335:Clcn7	APN	17	25146847	missense	probably benign	0.00
IGL02507:Clcn7	APN	17	25144469	missense	probably damaging	1.00
IGL02605:Clcn7	APN	17	25146818	missense	possibly damaging	0.60
IGL03160:Clcn7	APN	17	25146453	unclassified	probably benign
IGL03192:Clcn7	APN	17	25133601	missense	probably benign	0.00
IGL03194:Clcn7	APN	17	25150548	missense	probably damaging	0.98
IGL03409:Clcn7	APN	17	25155385	missense	probably damaging	1.00
R0140:Clcn7	UTSW	17	25153754	missense	probably damaging	1.00
R0153:Clcn7	UTSW	17	25149202	unclassified	probably benign
R0970:Clcn7	UTSW	17	25151234	critical splice donor site	probably null
R1644:Clcn7	UTSW	17	25159698	missense	probably damaging	1.00
R1856:Clcn7	UTSW	17	25160471	missense	probably damaging	1.00
R2145:Clcn7	UTSW	17	25144451	missense	probably benign
R2173:Clcn7	UTSW	17	25145609	missense	probably benign
R2401:Clcn7	UTSW	17	25153140	missense	probably benign	0.02
R2511:Clcn7	UTSW	17	25155446	missense	probably damaging	1.00
R3683:Clcn7	UTSW	17	25150593	missense	possibly damaging	0.84
R3684:Clcn7	UTSW	17	25150593	missense	possibly damaging	0.84
R3694:Clcn7	UTSW	17	25159707	missense	probably damaging	0.99
R4681:Clcn7	UTSW	17	25157961	missense	probably damaging	1.00
R4870:Clcn7	UTSW	17	25153565	intron	probably benign
R5372:Clcn7	UTSW	17	25157179	missense	possibly damaging	0.82
R5820:Clcn7	UTSW	17	25149052	missense	probably damaging	1.00
R6154:Clcn7	UTSW	17	25157954	missense	probably damaging	0.98
R6181:Clcn7	UTSW	17	25151728	missense	possibly damaging	0.79
R6306:Clcn7	UTSW	17	25157528	missense	probably benign	0.01
R6798:Clcn7	UTSW	17	25159760	missense	probably damaging	1.00
R6961:Clcn7	UTSW	17	25157214	missense	probably damaging	1.00
R7020:Clcn7	UTSW	17	25146351	missense	possibly damaging	0.76
R7089:Clcn7	UTSW	17	25153693	missense
R7757:Clcn7	UTSW	17	25156822	missense	probably damaging	1.00
R8057:Clcn7	UTSW	17	25149259	nonsense	probably null
R8670:Clcn7	UTSW	17	25159614	missense	probably damaging	0.99
X0020:Clcn7	UTSW	17	25150226	missense	probably damaging	1.00
Z1177:Clcn7	UTSW	17	25153015	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- TGAGGTGGCCATCTAACCAG -3'
(R):5'- AGTAATAGGCTAGGACCCAGGC -3'

Sequencing Primer
(F):5'- TAGCATTACACAGGTCCTTAGAGTC -3'
(R):5'- TAGGACCCAGGCTTACTGTC -3'

Posted On

2015-07-07