Mutagenetix > Incidental Mutation

Incidental Mutation 'R4424:Msh6'

327296

Institutional Source

Beutler Lab

Gene Symbol

Msh6

Ensembl Gene

ENSMUSG00000005370

Gene Name

mutS homolog 6

Synonyms

GTBP, Gtmbp, Msh6

MMRRC Submission

041696-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4424 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

87975050-87990883 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

T to A at 87990789 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Stop codon at position 1354 (L1354*)

Ref Sequence

ENSEMBL: ENSMUSP00000005503 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000005503] [ENSMUST00000005504]

AlphaFold

P54276

Predicted Effect

probably null
Transcript: ENSMUST00000005503
AA Change: L1354*

SMART Domains

Protein: ENSMUSP00000005503
Gene: ENSMUSG00000005370
AA Change: L1354*

Domain	Start	End	E-Value	Type
low complexity region	23	46	N/A	INTRINSIC
low complexity region	76	87	N/A	INTRINSIC
PWWP	90	152	9.01e-30	SMART
low complexity region	198	212	N/A	INTRINSIC
low complexity region	216	230	N/A	INTRINSIC
low complexity region	239	264	N/A	INTRINSIC
low complexity region	273	291	N/A	INTRINSIC
low complexity region	373	389	N/A	INTRINSIC
Pfam:MutS_I	406	525	4.7e-35	PFAM
Pfam:MutS_II	536	700	1.4e-10	PFAM
MUTSd	750	1100	4.56e-86	SMART
MUTSac	1125	1319	1.68e-116	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000005504

SMART Domains

Protein: ENSMUSP00000005504
Gene: ENSMUSG00000005371

Domain	Start	End	E-Value	Type
low complexity region	2	20	N/A	INTRINSIC
low complexity region	21	73	N/A	INTRINSIC
FBOX	162	202	2.44e-8	SMART
PbH1	398	420	1.37e3	SMART
PbH1	421	443	8.83e0	SMART
CASH	421	557	1.31e-7	SMART
PbH1	444	466	6.15e1	SMART
PbH1	467	489	1.78e3	SMART
PbH1	490	512	2.29e2	SMART
PbH1	513	535	7.67e2	SMART
PbH1	536	558	1.36e0	SMART
PbH1	559	581	3.59e0	SMART
CASH	573	695	2.35e0	SMART
PbH1	582	604	8.73e2	SMART
PbH1	605	627	4.28e2	SMART
PbH1	628	650	5.03e2	SMART
PbH1	651	673	3.79e1	SMART
PbH1	674	696	4.73e0	SMART
PbH1	697	719	1.86e2	SMART
CASH	711	840	9.31e-13	SMART
PbH1	720	742	2.91e0	SMART
PbH1	743	765	3.73e2	SMART
PbH1	766	788	1.62e2	SMART
PbH1	789	811	9.99e1	SMART
PbH1	812	833	1.21e3	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127334

Predicted Effect

probably benign
Transcript: ENSMUST00000130379

SMART Domains

Protein: ENSMUSP00000121206
Gene: ENSMUSG00000005371

Domain	Start	End	E-Value	Type
FBOX	87	127	2.44e-8	SMART
PbH1	323	345	1.37e3	SMART
PbH1	346	368	8.83e0	SMART
CASH	346	482	1.31e-7	SMART
PbH1	369	391	6.15e1	SMART
PbH1	392	414	1.78e3	SMART
PbH1	415	437	2.29e2	SMART
PbH1	438	460	7.67e2	SMART
PbH1	461	483	1.36e0	SMART
PbH1	484	506	3.59e0	SMART
CASH	498	620	2.35e0	SMART
PbH1	507	529	8.73e2	SMART
PbH1	530	552	4.28e2	SMART
PbH1	553	575	5.03e2	SMART
PbH1	576	598	3.79e1	SMART
PbH1	599	621	4.73e0	SMART
PbH1	622	644	1.86e2	SMART
CASH	636	765	9.31e-13	SMART
PbH1	645	667	2.91e0	SMART
PbH1	668	690	3.73e2	SMART
PbH1	691	713	1.62e2	SMART
PbH1	714	736	9.99e1	SMART
PbH1	737	758	1.21e3	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000135639

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.3%

Validation Efficiency

95% (69/73)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DNA mismatch repair MutS family. In E. coli, the MutS protein helps in the recognition of mismatched nucleotides prior to their repair. A highly conserved region of approximately 150 aa, called the Walker-A adenine nucleotide binding motif, exists in MutS homologs. The encoded protein heterodimerizes with MSH2 to form a mismatch recognition complex that functions as a bidirectional molecular switch that exchanges ADP and ATP as DNA mismatches are bound and dissociated. Mutations in this gene may be associated with hereditary nonpolyposis colon cancer, colorectal cancer, and endometrial cancer. Transcripts variants encoding different isoforms have been described. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit premature death and are predisposed to tumor formation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933409G03Rik	A	T	2: 68,615,147		probably benign	Het
Aimp1	A	T	3: 132,667,492	L229Q	probably benign	Het
Ankrd16	T	A	2: 11,784,404	D267E	possibly damaging	Het
Apol11b	A	G	15: 77,637,933		probably null	Het
Arfgap1	C	A	2: 180,981,076	D327E	probably benign	Het
Arid3b	A	T	9: 57,833,868	D98E	probably benign	Het
Art2b	T	A	7: 101,579,922	I257F	probably benign	Het
Atp5a1	T	A	18: 77,780,066		probably benign	Het
Carmil3	A	G	14: 55,501,471	T861A	probably benign	Het
Cep164	A	T	9: 45,779,704	F1259L	possibly damaging	Het
Chrnd	T	C	1: 87,195,790	V350A	probably benign	Het
Clcn7	T	C	17: 25,160,176	L744P	probably damaging	Het
Csl	T	A	10: 99,758,591	D204V	possibly damaging	Het
Cyp2c29	G	T	19: 39,287,176	W20L	probably damaging	Het
Dhrs13	G	T	11: 78,037,125	G266*	probably null	Het
Dll3	T	C	7: 28,296,291	N362D	probably damaging	Het
Fanca	A	G	8: 123,288,793	V715A	probably benign	Het
Fhod1	T	C	8: 105,337,351		probably benign	Het
Fpr2	C	T	17: 17,893,132	P130L	probably damaging	Het
Glce	A	G	9: 62,060,253	Y539H	probably damaging	Het
Gm11639	T	G	11: 104,736,114		probably null	Het
Gm4758	A	G	16: 36,312,589	D76G	probably null	Het
Hfe	A	T	13: 23,706,883	V91E	probably benign	Het
Hoxd13	A	T	2: 74,669,957	K281*	probably null	Het
Ighv1-66	A	T	12: 115,593,537	W3R	probably damaging	Het
Impg2	G	A	16: 56,260,025	V622I	possibly damaging	Het
Jun	A	G	4: 95,050,847	M142T	probably benign	Het
Krt78	T	C	15: 101,947,940	T479A	probably benign	Het
Lama3	T	A	18: 12,519,872	C216*	probably null	Het
Lin54	G	T	5: 100,446,560	T582K	probably damaging	Het
Maats1	G	T	16: 38,320,365	P409T	probably damaging	Het
Mapk11	A	G	15: 89,145,373		probably null	Het
Mindy3	A	G	2: 12,348,199	M397T	probably benign	Het
Mrpl41	T	C	2: 24,974,406	T85A	possibly damaging	Het
Mtmr12	T	C	15: 12,230,314	V41A	probably damaging	Het
Myh2	A	T	11: 67,192,725	Q1478L	probably benign	Het
Myo6	A	G	9: 80,288,038	K897E	probably benign	Het
Naprt	G	T	15: 75,892,756		probably null	Het
Nrl	G	A	14: 55,522,218	S84L	probably benign	Het
Nxf1	A	G	19: 8,766,764		probably benign	Het
Olfr971	A	T	9: 39,840,356	R307S	possibly damaging	Het
Panx2	G	T	15: 89,068,220	V305F	probably benign	Het
Pcdhga1	T	C	18: 37,662,579	L212P	probably damaging	Het
Pik3ap1	G	A	19: 41,375,881	T133I	probably benign	Het
Ppat	A	G	5: 76,915,214	W517R	probably damaging	Het
Ppp1r16b	C	T	2: 158,757,254	T382I	probably benign	Het
Prkdc	A	G	16: 15,773,739	K2694E	probably damaging	Het
Prkdc	G	A	16: 15,836,082	R3901H	probably damaging	Het
Psma8	A	G	18: 14,721,190	I42M	probably damaging	Het
Ptprd	A	T	4: 76,102,963	M599K	probably benign	Het
Rnmt	A	G	18: 68,311,671	D237G	probably null	Het
Rpl31-ps17	C	T	12: 54,701,612		noncoding transcript	Het
Scaf11	G	A	15: 96,418,428	T1085I	possibly damaging	Het
Sec14l3	G	A	11: 4,066,210	R43Q	probably damaging	Het
Shc4	G	T	2: 125,652,522	T131K	probably benign	Het
Snx27	A	G	3: 94,562,023	F4L	probably benign	Het
Sorcs1	T	C	19: 50,378,941	T228A	probably damaging	Het
Sptan1	C	T	2: 30,029,709		probably benign	Het
Syvn1	C	T	19: 6,049,921		probably benign	Het
Tex47	G	T	5: 7,305,364	A182S	probably benign	Het
Thegl	T	C	5: 77,054,536	I268T	possibly damaging	Het
Tpcn1	T	C	5: 120,542,518	K549R	probably damaging	Het
Upf3a	C	A	8: 13,796,573	P318T	probably benign	Het
Zbtb40	A	T	4: 136,998,694	M518K	probably damaging	Het
Zcchc14	G	A	8: 121,651,941		probably benign	Het
Zfp687	G	A	3: 95,009,128	P861L	probably damaging	Het

Other mutations in Msh6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01691:Msh6	APN	17	87985479	missense	probably benign
IGL01834:Msh6	APN	17	87985712	missense	probably damaging	1.00
IGL01904:Msh6	APN	17	87984732	missense	probably benign
IGL01957:Msh6	APN	17	87985091	missense	possibly damaging	0.73
IGL02117:Msh6	APN	17	87990806	unclassified	probably benign
IGL02234:Msh6	APN	17	87986801	missense	probably damaging	1.00
IGL02512:Msh6	APN	17	87984732	missense	probably benign
IGL02651:Msh6	APN	17	87989515	missense	probably damaging	1.00
IGL03381:Msh6	APN	17	87985109	missense	probably damaging	1.00
medea	UTSW	17	87980223	nonsense	probably null
medusa	UTSW	17	87988463	unclassified	probably benign
PIT4449001:Msh6	UTSW	17	87986188	missense	probably damaging	0.96
R0196:Msh6	UTSW	17	87980360	missense	possibly damaging	0.95
R0324:Msh6	UTSW	17	87986620	nonsense	probably null
R0492:Msh6	UTSW	17	87975251	missense	probably benign
R0711:Msh6	UTSW	17	87986684	missense	probably damaging	1.00
R1065:Msh6	UTSW	17	87988463	unclassified	probably benign
R1454:Msh6	UTSW	17	87984758	missense	probably benign	0.00
R1740:Msh6	UTSW	17	87985722	missense	possibly damaging	0.72
R1770:Msh6	UTSW	17	87980223	nonsense	probably null
R1771:Msh6	UTSW	17	87984522	missense	probably benign	0.17
R1919:Msh6	UTSW	17	87985125	missense	probably benign	0.01
R1926:Msh6	UTSW	17	87986225	missense	probably benign
R2026:Msh6	UTSW	17	87990343	missense	probably damaging	1.00
R2095:Msh6	UTSW	17	87988233	missense	possibly damaging	0.93
R2097:Msh6	UTSW	17	87985416	missense	probably benign	0.00
R2149:Msh6	UTSW	17	87986088	missense	probably damaging	1.00
R2156:Msh6	UTSW	17	87986140	nonsense	probably null
R2167:Msh6	UTSW	17	87989483	missense	probably damaging	1.00
R2382:Msh6	UTSW	17	87984731	missense	probably benign
R3005:Msh6	UTSW	17	87988285	missense	probably benign	0.34
R3160:Msh6	UTSW	17	87985481	missense	probably damaging	1.00
R3162:Msh6	UTSW	17	87985481	missense	probably damaging	1.00
R3162:Msh6	UTSW	17	87985481	missense	probably damaging	1.00
R3774:Msh6	UTSW	17	87986181	missense	probably damaging	1.00
R3775:Msh6	UTSW	17	87986181	missense	probably damaging	1.00
R4350:Msh6	UTSW	17	87984584	missense	probably damaging	1.00
R4499:Msh6	UTSW	17	87980269	missense	probably damaging	1.00
R4667:Msh6	UTSW	17	87984806	missense	possibly damaging	0.89
R4668:Msh6	UTSW	17	87984806	missense	possibly damaging	0.89
R4669:Msh6	UTSW	17	87984806	missense	possibly damaging	0.89
R4849:Msh6	UTSW	17	87983519	missense	possibly damaging	0.94
R5137:Msh6	UTSW	17	87980288	missense	possibly damaging	0.83
R5472:Msh6	UTSW	17	87984561	missense	possibly damaging	0.81
R5594:Msh6	UTSW	17	87986069	missense	probably benign	0.00
R5607:Msh6	UTSW	17	87986901	missense	probably damaging	1.00
R5608:Msh6	UTSW	17	87986901	missense	probably damaging	1.00
R5660:Msh6	UTSW	17	87984719	missense	possibly damaging	0.94
R6243:Msh6	UTSW	17	87983571	missense	possibly damaging	0.69
R6279:Msh6	UTSW	17	87980249	missense	probably damaging	1.00
R6357:Msh6	UTSW	17	87984460	nonsense	probably null
R6399:Msh6	UTSW	17	87986891	missense	probably damaging	1.00
R6453:Msh6	UTSW	17	87985739	missense	probably damaging	1.00
R6646:Msh6	UTSW	17	87986442	missense	possibly damaging	0.80
R7404:Msh6	UTSW	17	87975120
R7837:Msh6	UTSW	17	87984666	missense	probably damaging	1.00
R8004:Msh6	UTSW	17	87986787	missense	probably damaging	1.00
R8296:Msh6	UTSW	17	87986912	missense	probably damaging	1.00
R8326:Msh6	UTSW	17	87986912	missense	probably damaging	1.00
R8377:Msh6	UTSW	17	87985170	missense	probably damaging	1.00
R8715:Msh6	UTSW	17	87985767	missense	probably benign
R9752:Msh6	UTSW	17	87986535	missense	probably damaging	1.00
X0026:Msh6	UTSW	17	87986181	missense	probably damaging	1.00
X0026:Msh6	UTSW	17	87990614	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- CAAGGCTTGCTAATCTCCCG -3'
(R):5'- GCCTGAAAGTGTATGCATGTAC -3'

Sequencing Primer
(F):5'- GAATCAGTCATTACAGCTATTTCGG -3'
(R):5'- CTGAAAGTGTATGCATGTACCATAAC -3'

Posted On

2015-07-07