Incidental Mutation 'R4424:Pcdhga1'
ID327299
Institutional Source Beutler Lab
Gene Symbol Pcdhga1
Ensembl Gene ENSMUSG00000103144
Gene Nameprotocadherin gamma subfamily A, 1
Synonyms
MMRRC Submission 041696-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4424 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location37661793-37841873 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 37662579 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 212 (L212P)
Ref Sequence ENSEMBL: ENSMUSP00000142062 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115661] [ENSMUST00000194190] [ENSMUST00000194544] [ENSMUST00000194888]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000097608
SMART Domains Protein: ENSMUSP00000095213
Gene: ENSMUSG00000073590

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
transmembrane domain 57 79 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192137
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably damaging
Transcript: ENSMUST00000194190
AA Change: L212P

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000142062
Gene: ENSMUSG00000103144
AA Change: L212P

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
CA 31 131 3.16e-2 SMART
CA 155 240 5.39e-16 SMART
CA 264 345 6.72e-26 SMART
CA 369 450 1.32e-24 SMART
CA 474 560 4.17e-22 SMART
CA 591 669 4.48e-13 SMART
transmembrane domain 692 714 N/A INTRINSIC
low complexity region 912 931 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194328
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000194888
AA Change: L212P

PolyPhen 2 Score 0.824 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000141367
Gene: ENSMUSG00000103144
AA Change: L212P

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
CA 31 131 1.6e-4 SMART
CA 155 240 2.7e-18 SMART
CA 264 345 3.3e-28 SMART
CA 369 450 6.7e-27 SMART
CA 474 560 2e-24 SMART
CA 591 669 2.2e-15 SMART
transmembrane domain 692 714 N/A INTRINSIC
Meta Mutation Damage Score 0.9016 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 95% (69/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the protocadherin gamma gene cluster, one of three related clusters tandemly linked on chromosome five. These gene clusters have an immunoglobulin-like organization, suggesting that a novel mechanism may be involved in their regulation and expression. The gamma gene cluster includes 22 genes divided into 3 subfamilies. Subfamily A contains 12 genes, subfamily B contains 7 genes and 2 pseudogenes, and the more distantly related subfamily C contains 3 genes. The tandem array of 22 large, variable region exons are followed by a constant region, containing 3 exons shared by all genes in the cluster. Each variable region exon encodes the extracellular region, which includes 6 cadherin ectodomains and a transmembrane region. The constant region exons encode the common cytoplasmic region. These neural cadherin-like cell adhesion proteins most likely play a critical role in the establishment and function of specific cell-cell connections in the brain. Alternative splicing has been described for the gamma cluster genes. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null/reporter allele are viable and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933409G03Rik A T 2: 68,615,147 probably benign Het
Aimp1 A T 3: 132,667,492 L229Q probably benign Het
Ankrd16 T A 2: 11,784,404 D267E possibly damaging Het
Apol11b A G 15: 77,637,933 probably null Het
Arfgap1 C A 2: 180,981,076 D327E probably benign Het
Arid3b A T 9: 57,833,868 D98E probably benign Het
Art2b T A 7: 101,579,922 I257F probably benign Het
Atp5a1 T A 18: 77,780,066 probably benign Het
Carmil3 A G 14: 55,501,471 T861A probably benign Het
Cep164 A T 9: 45,779,704 F1259L possibly damaging Het
Chrnd T C 1: 87,195,790 V350A probably benign Het
Clcn7 T C 17: 25,160,176 L744P probably damaging Het
Csl T A 10: 99,758,591 D204V possibly damaging Het
Cyp2c29 G T 19: 39,287,176 W20L probably damaging Het
Dhrs13 G T 11: 78,037,125 G266* probably null Het
Dll3 T C 7: 28,296,291 N362D probably damaging Het
Fanca A G 8: 123,288,793 V715A probably benign Het
Fhod1 T C 8: 105,337,351 probably benign Het
Fpr2 C T 17: 17,893,132 P130L probably damaging Het
Glce A G 9: 62,060,253 Y539H probably damaging Het
Gm11639 T G 11: 104,736,114 probably null Het
Gm4758 A G 16: 36,312,589 D76G probably null Het
Hfe A T 13: 23,706,883 V91E probably benign Het
Hoxd13 A T 2: 74,669,957 K281* probably null Het
Ighv1-66 A T 12: 115,593,537 W3R probably damaging Het
Impg2 G A 16: 56,260,025 V622I possibly damaging Het
Jun A G 4: 95,050,847 M142T probably benign Het
Krt78 T C 15: 101,947,940 T479A probably benign Het
Lama3 T A 18: 12,519,872 C216* probably null Het
Lin54 G T 5: 100,446,560 T582K probably damaging Het
Maats1 G T 16: 38,320,365 P409T probably damaging Het
Mapk11 A G 15: 89,145,373 probably null Het
Mindy3 A G 2: 12,348,199 M397T probably benign Het
Mrpl41 T C 2: 24,974,406 T85A possibly damaging Het
Msh6 T A 17: 87,990,789 L1354* probably null Het
Mtmr12 T C 15: 12,230,314 V41A probably damaging Het
Myh2 A T 11: 67,192,725 Q1478L probably benign Het
Myo6 A G 9: 80,288,038 K897E probably benign Het
Naprt G T 15: 75,892,756 probably null Het
Nrl G A 14: 55,522,218 S84L probably benign Het
Nxf1 A G 19: 8,766,764 probably benign Het
Olfr971 A T 9: 39,840,356 R307S possibly damaging Het
Panx2 G T 15: 89,068,220 V305F probably benign Het
Pik3ap1 G A 19: 41,375,881 T133I probably benign Het
Ppat A G 5: 76,915,214 W517R probably damaging Het
Ppp1r16b C T 2: 158,757,254 T382I probably benign Het
Prkdc A G 16: 15,773,739 K2694E probably damaging Het
Prkdc G A 16: 15,836,082 R3901H probably damaging Het
Psma8 A G 18: 14,721,190 I42M probably damaging Het
Ptprd A T 4: 76,102,963 M599K probably benign Het
Rnmt A G 18: 68,311,671 D237G probably null Het
Rpl31-ps17 C T 12: 54,701,612 noncoding transcript Het
Scaf11 G A 15: 96,418,428 T1085I possibly damaging Het
Sec14l3 G A 11: 4,066,210 R43Q probably damaging Het
Shc4 G T 2: 125,652,522 T131K probably benign Het
Snx27 A G 3: 94,562,023 F4L probably benign Het
Sorcs1 T C 19: 50,378,941 T228A probably damaging Het
Sptan1 C T 2: 30,029,709 probably benign Het
Syvn1 C T 19: 6,049,921 probably benign Het
Tex47 G T 5: 7,305,364 A182S probably benign Het
Thegl T C 5: 77,054,536 I268T possibly damaging Het
Tpcn1 T C 5: 120,542,518 K549R probably damaging Het
Upf3a C A 8: 13,796,573 P318T probably benign Het
Zbtb40 A T 4: 136,998,694 M518K probably damaging Het
Zcchc14 G A 8: 121,651,941 probably benign Het
Zfp687 G A 3: 95,009,128 P861L probably damaging Het
Other mutations in Pcdhga1
AlleleSourceChrCoordTypePredicted EffectPPH Score
BB009:Pcdhga1 UTSW 18 37663460 missense probably damaging 1.00
BB019:Pcdhga1 UTSW 18 37663460 missense probably damaging 1.00
R1074:Pcdhga1 UTSW 18 37825087 splice site probably benign
R1869:Pcdhga1 UTSW 18 37840090 missense probably damaging 0.98
R1871:Pcdhga1 UTSW 18 37840090 missense probably damaging 0.98
R3723:Pcdhga1 UTSW 18 37662992 missense possibly damaging 0.89
R3732:Pcdhga1 UTSW 18 37664123 missense probably benign 0.00
R4243:Pcdhga1 UTSW 18 37663552 missense probably damaging 1.00
R4245:Pcdhga1 UTSW 18 37663552 missense probably damaging 1.00
R4898:Pcdhga1 UTSW 18 37662354 missense possibly damaging 0.63
R4941:Pcdhga1 UTSW 18 37662606 missense probably benign 0.10
R5021:Pcdhga1 UTSW 18 37663823 missense probably damaging 1.00
R5765:Pcdhga1 UTSW 18 37663661 missense probably benign 0.31
R6176:Pcdhga1 UTSW 18 37664229 missense probably benign 0.22
R6380:Pcdhga1 UTSW 18 37662969 missense probably damaging 1.00
R7062:Pcdhga1 UTSW 18 37825077 missense probably damaging 1.00
R7146:Pcdhga1 UTSW 18 37662111 missense probably benign 0.04
R7266:Pcdhga1 UTSW 18 37839975 missense possibly damaging 0.94
R7525:Pcdhga1 UTSW 18 37662228 missense probably damaging 1.00
R7553:Pcdhga1 UTSW 18 37749682 splice site probably null
R7581:Pcdhga1 UTSW 18 37662177 missense probably damaging 1.00
R7932:Pcdhga1 UTSW 18 37663460 missense probably damaging 1.00
R8330:Pcdhga1 UTSW 18 37663323 missense probably benign 0.19
R8385:Pcdhga1 UTSW 18 37662096 missense probably damaging 1.00
R8549:Pcdhga1 UTSW 18 37833333 makesense probably null
Predicted Primers PCR Primer
(F):5'- TCTCGGGCAAGACCTTGATG -3'
(R):5'- CACACTGTGGTCTACCTTGTGAAAG -3'

Sequencing Primer
(F):5'- CCTTGATGTGGGGATAAACTCAC -3'
(R):5'- AGTAGGTTACTCTGCCATTAGC -3'
Posted On2015-07-07