Incidental Mutation 'R4424:Nxf1'
ID327303
Institutional Source Beutler Lab
Gene Symbol Nxf1
Ensembl Gene ENSMUSG00000010097
Gene Namenuclear RNA export factor 1
SynonymsTip associated protein, Mex67, TAP, Mvb1
MMRRC Submission 041696-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4424 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location8757073-8772475 bp(+) (GRCm38)
Type of Mutationutr 3 prime
DNA Base Change (assembly) A to G at 8766764 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000139124 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010241] [ENSMUST00000010248] [ENSMUST00000183939] [ENSMUST00000184756] [ENSMUST00000184970]
Predicted Effect probably benign
Transcript: ENSMUST00000010241
SMART Domains Protein: ENSMUSP00000010241
Gene: ENSMUSG00000010097

DomainStartEndE-ValueType
low complexity region 33 50 N/A INTRINSIC
low complexity region 67 81 N/A INTRINSIC
Pfam:Tap-RNA_bind 115 198 7.6e-42 PFAM
low complexity region 258 274 N/A INTRINSIC
LRRcap 333 351 1.44e0 SMART
Pfam:NTF2 385 535 1.3e-29 PFAM
TAP_C 555 618 1.85e-33 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000010248
SMART Domains Protein: ENSMUSP00000010248
Gene: ENSMUSG00000010097

DomainStartEndE-ValueType
Pfam:TMEM223 32 197 6.5e-64 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183780
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183898
Predicted Effect probably benign
Transcript: ENSMUST00000183939
SMART Domains Protein: ENSMUSP00000139351
Gene: ENSMUSG00000010097

DomainStartEndE-ValueType
Pfam:Tap-RNA_bind 1 63 5.7e-28 PFAM
low complexity region 122 138 N/A INTRINSIC
Pfam:LRR_1 155 178 2.1e-2 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184387
Predicted Effect probably benign
Transcript: ENSMUST00000184756
SMART Domains Protein: ENSMUSP00000139050
Gene: ENSMUSG00000010097

DomainStartEndE-ValueType
low complexity region 33 50 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184808
Predicted Effect probably benign
Transcript: ENSMUST00000184826
Predicted Effect probably benign
Transcript: ENSMUST00000184970
SMART Domains Protein: ENSMUSP00000139124
Gene: ENSMUSG00000010097

DomainStartEndE-ValueType
low complexity region 33 50 N/A INTRINSIC
low complexity region 67 81 N/A INTRINSIC
Pfam:Tap-RNA_bind 112 199 2.4e-45 PFAM
low complexity region 258 274 N/A INTRINSIC
Pfam:LRR_1 291 314 3.2e-2 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185056
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 95% (69/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is one member of a family of nuclear RNA export factor genes. Common domain features of this family are a noncanonical RNP-type RNA-binding domain (RBD), 4 leucine-rich repeats (LRRs), a nuclear transport factor 2 (NTF2)-like domain that allows heterodimerization with NTF2-related export protein-1 (NXT1), and a ubiquitin-associated domain that mediates interactions with nucleoporins. The LRRs and NTF2-like domains are required for export activity. Alternative splicing seems to be a common mechanism in this gene family. The encoded protein of this gene shuttles between the nucleus and the cytoplasm and binds in vivo to poly(A)+ RNA. It is the vertebrate homologue of the yeast protein Mex67p. The encoded protein overcomes the mRNA export block caused by the presence of saturating amounts of CTE (constitutive transport element) RNA of type D retroviruses. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for some alleles are able to suppress defects caused by retrovirus insertion mutations. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933409G03Rik A T 2: 68,615,147 probably benign Het
Aimp1 A T 3: 132,667,492 L229Q probably benign Het
Ankrd16 T A 2: 11,784,404 D267E possibly damaging Het
Apol11b A G 15: 77,637,933 probably null Het
Arfgap1 C A 2: 180,981,076 D327E probably benign Het
Arid3b A T 9: 57,833,868 D98E probably benign Het
Art2b T A 7: 101,579,922 I257F probably benign Het
Atp5a1 T A 18: 77,780,066 probably benign Het
Carmil3 A G 14: 55,501,471 T861A probably benign Het
Cep164 A T 9: 45,779,704 F1259L possibly damaging Het
Chrnd T C 1: 87,195,790 V350A probably benign Het
Clcn7 T C 17: 25,160,176 L744P probably damaging Het
Csl T A 10: 99,758,591 D204V possibly damaging Het
Cyp2c29 G T 19: 39,287,176 W20L probably damaging Het
Dhrs13 G T 11: 78,037,125 G266* probably null Het
Dll3 T C 7: 28,296,291 N362D probably damaging Het
Fanca A G 8: 123,288,793 V715A probably benign Het
Fhod1 T C 8: 105,337,351 probably benign Het
Fpr2 C T 17: 17,893,132 P130L probably damaging Het
Glce A G 9: 62,060,253 Y539H probably damaging Het
Gm11639 T G 11: 104,736,114 probably null Het
Gm4758 A G 16: 36,312,589 D76G probably null Het
Hfe A T 13: 23,706,883 V91E probably benign Het
Hoxd13 A T 2: 74,669,957 K281* probably null Het
Ighv1-66 A T 12: 115,593,537 W3R probably damaging Het
Impg2 G A 16: 56,260,025 V622I possibly damaging Het
Jun A G 4: 95,050,847 M142T probably benign Het
Krt78 T C 15: 101,947,940 T479A probably benign Het
Lama3 T A 18: 12,519,872 C216* probably null Het
Lin54 G T 5: 100,446,560 T582K probably damaging Het
Maats1 G T 16: 38,320,365 P409T probably damaging Het
Mapk11 A G 15: 89,145,373 probably null Het
Mindy3 A G 2: 12,348,199 M397T probably benign Het
Mrpl41 T C 2: 24,974,406 T85A possibly damaging Het
Msh6 T A 17: 87,990,789 L1354* probably null Het
Mtmr12 T C 15: 12,230,314 V41A probably damaging Het
Myh2 A T 11: 67,192,725 Q1478L probably benign Het
Myo6 A G 9: 80,288,038 K897E probably benign Het
Naprt G T 15: 75,892,756 probably null Het
Nrl G A 14: 55,522,218 S84L probably benign Het
Olfr971 A T 9: 39,840,356 R307S possibly damaging Het
Panx2 G T 15: 89,068,220 V305F probably benign Het
Pcdhga1 T C 18: 37,662,579 L212P probably damaging Het
Pik3ap1 G A 19: 41,375,881 T133I probably benign Het
Ppat A G 5: 76,915,214 W517R probably damaging Het
Ppp1r16b C T 2: 158,757,254 T382I probably benign Het
Prkdc A G 16: 15,773,739 K2694E probably damaging Het
Prkdc G A 16: 15,836,082 R3901H probably damaging Het
Psma8 A G 18: 14,721,190 I42M probably damaging Het
Ptprd A T 4: 76,102,963 M599K probably benign Het
Rnmt A G 18: 68,311,671 D237G probably null Het
Rpl31-ps17 C T 12: 54,701,612 noncoding transcript Het
Scaf11 G A 15: 96,418,428 T1085I possibly damaging Het
Sec14l3 G A 11: 4,066,210 R43Q probably damaging Het
Shc4 G T 2: 125,652,522 T131K probably benign Het
Snx27 A G 3: 94,562,023 F4L probably benign Het
Sorcs1 T C 19: 50,378,941 T228A probably damaging Het
Sptan1 C T 2: 30,029,709 probably benign Het
Syvn1 C T 19: 6,049,921 probably benign Het
Tex47 G T 5: 7,305,364 A182S probably benign Het
Thegl T C 5: 77,054,536 I268T possibly damaging Het
Tpcn1 T C 5: 120,542,518 K549R probably damaging Het
Upf3a C A 8: 13,796,573 P318T probably benign Het
Zbtb40 A T 4: 136,998,694 M518K probably damaging Het
Zcchc14 G A 8: 121,651,941 probably benign Het
Zfp687 G A 3: 95,009,128 P861L probably damaging Het
Other mutations in Nxf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Nxf1 APN 19 8762742 missense possibly damaging 0.95
IGL02318:Nxf1 APN 19 8764150 critical splice donor site probably null
IGL03383:Nxf1 APN 19 8763697 missense probably damaging 1.00
Chance UTSW 19 8769182 missense probably damaging 1.00
Possibility UTSW 19 8767744 missense probably damaging 1.00
Probability UTSW 19 8764317 missense probably benign 0.01
R0125:Nxf1 UTSW 19 8762806 missense probably benign 0.37
R0362:Nxf1 UTSW 19 8764151 critical splice donor site probably null
R0374:Nxf1 UTSW 19 8767739 missense possibly damaging 0.86
R0403:Nxf1 UTSW 19 8765028 missense probably damaging 1.00
R0883:Nxf1 UTSW 19 8764591 missense probably damaging 1.00
R1004:Nxf1 UTSW 19 8764317 missense probably benign 0.01
R1068:Nxf1 UTSW 19 8762754 missense probably damaging 0.97
R1503:Nxf1 UTSW 19 8762436 missense probably benign
R1669:Nxf1 UTSW 19 8772131 missense possibly damaging 0.93
R1679:Nxf1 UTSW 19 8769074 missense probably benign
R4608:Nxf1 UTSW 19 8762763 missense probably benign 0.03
R4783:Nxf1 UTSW 19 8766798 missense probably benign 0.01
R4969:Nxf1 UTSW 19 8762305 splice site probably null
R5233:Nxf1 UTSW 19 8763929 missense possibly damaging 0.67
R5370:Nxf1 UTSW 19 8772140 missense probably damaging 1.00
R6024:Nxf1 UTSW 19 8767744 missense probably damaging 1.00
R6058:Nxf1 UTSW 19 8767822 missense probably damaging 1.00
R6063:Nxf1 UTSW 19 8767787 missense possibly damaging 0.46
R6293:Nxf1 UTSW 19 8769182 missense probably damaging 1.00
R6378:Nxf1 UTSW 19 8764546 missense probably benign 0.19
RF021:Nxf1 UTSW 19 8772309 missense probably damaging 1.00
X0024:Nxf1 UTSW 19 8763764 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- AACAGAGCCAGCCTTCAAGG -3'
(R):5'- GGATCCTATATAAACTTTGTCCACAGG -3'

Sequencing Primer
(F):5'- CCTTCAAGGCAATTAAGAAGGG -3'
(R):5'- GTCCACAGGCATTTCTAAGATG -3'
Posted On2015-07-07