Incidental Mutation 'R4424:Pik3ap1'
ID327305
Institutional Source Beutler Lab
Gene Symbol Pik3ap1
Ensembl Gene ENSMUSG00000025017
Gene Namephosphoinositide-3-kinase adaptor protein 1
SynonymsBCAP, 1810044J04Rik
MMRRC Submission 041696-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4424 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location41274218-41385070 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 41375881 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 133 (T133I)
Ref Sequence ENSEMBL: ENSMUSP00000052777 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059672]
Predicted Effect probably benign
Transcript: ENSMUST00000059672
AA Change: T133I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000052777
Gene: ENSMUSG00000025017
AA Change: T133I

DomainStartEndE-ValueType
DBB 180 319 8.55e-75 SMART
SCOP:d1bd8__ 331 396 8e-5 SMART
Blast:ANK 336 365 1e-7 BLAST
low complexity region 533 552 N/A INTRINSIC
low complexity region 716 740 N/A INTRINSIC
low complexity region 802 808 N/A INTRINSIC
Meta Mutation Damage Score 0.0697 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 95% (69/73)
MGI Phenotype PHENOTYPE: Mice homozygous for disruptions in this gene have abnormalities in B cell maturation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933409G03Rik A T 2: 68,615,147 probably benign Het
Aimp1 A T 3: 132,667,492 L229Q probably benign Het
Ankrd16 T A 2: 11,784,404 D267E possibly damaging Het
Apol11b A G 15: 77,637,933 probably null Het
Arfgap1 C A 2: 180,981,076 D327E probably benign Het
Arid3b A T 9: 57,833,868 D98E probably benign Het
Art2b T A 7: 101,579,922 I257F probably benign Het
Atp5a1 T A 18: 77,780,066 probably benign Het
Carmil3 A G 14: 55,501,471 T861A probably benign Het
Cep164 A T 9: 45,779,704 F1259L possibly damaging Het
Chrnd T C 1: 87,195,790 V350A probably benign Het
Clcn7 T C 17: 25,160,176 L744P probably damaging Het
Csl T A 10: 99,758,591 D204V possibly damaging Het
Cyp2c29 G T 19: 39,287,176 W20L probably damaging Het
Dhrs13 G T 11: 78,037,125 G266* probably null Het
Dll3 T C 7: 28,296,291 N362D probably damaging Het
Fanca A G 8: 123,288,793 V715A probably benign Het
Fhod1 T C 8: 105,337,351 probably benign Het
Fpr2 C T 17: 17,893,132 P130L probably damaging Het
Glce A G 9: 62,060,253 Y539H probably damaging Het
Gm11639 T G 11: 104,736,114 probably null Het
Gm4758 A G 16: 36,312,589 D76G probably null Het
Hfe A T 13: 23,706,883 V91E probably benign Het
Hoxd13 A T 2: 74,669,957 K281* probably null Het
Ighv1-66 A T 12: 115,593,537 W3R probably damaging Het
Impg2 G A 16: 56,260,025 V622I possibly damaging Het
Jun A G 4: 95,050,847 M142T probably benign Het
Krt78 T C 15: 101,947,940 T479A probably benign Het
Lama3 T A 18: 12,519,872 C216* probably null Het
Lin54 G T 5: 100,446,560 T582K probably damaging Het
Maats1 G T 16: 38,320,365 P409T probably damaging Het
Mapk11 A G 15: 89,145,373 probably null Het
Mindy3 A G 2: 12,348,199 M397T probably benign Het
Mrpl41 T C 2: 24,974,406 T85A possibly damaging Het
Msh6 T A 17: 87,990,789 L1354* probably null Het
Mtmr12 T C 15: 12,230,314 V41A probably damaging Het
Myh2 A T 11: 67,192,725 Q1478L probably benign Het
Myo6 A G 9: 80,288,038 K897E probably benign Het
Naprt G T 15: 75,892,756 probably null Het
Nrl G A 14: 55,522,218 S84L probably benign Het
Nxf1 A G 19: 8,766,764 probably benign Het
Olfr971 A T 9: 39,840,356 R307S possibly damaging Het
Panx2 G T 15: 89,068,220 V305F probably benign Het
Pcdhga1 T C 18: 37,662,579 L212P probably damaging Het
Ppat A G 5: 76,915,214 W517R probably damaging Het
Ppp1r16b C T 2: 158,757,254 T382I probably benign Het
Prkdc A G 16: 15,773,739 K2694E probably damaging Het
Prkdc G A 16: 15,836,082 R3901H probably damaging Het
Psma8 A G 18: 14,721,190 I42M probably damaging Het
Ptprd A T 4: 76,102,963 M599K probably benign Het
Rnmt A G 18: 68,311,671 D237G probably null Het
Rpl31-ps17 C T 12: 54,701,612 noncoding transcript Het
Scaf11 G A 15: 96,418,428 T1085I possibly damaging Het
Sec14l3 G A 11: 4,066,210 R43Q probably damaging Het
Shc4 G T 2: 125,652,522 T131K probably benign Het
Snx27 A G 3: 94,562,023 F4L probably benign Het
Sorcs1 T C 19: 50,378,941 T228A probably damaging Het
Sptan1 C T 2: 30,029,709 probably benign Het
Syvn1 C T 19: 6,049,921 probably benign Het
Tex47 G T 5: 7,305,364 A182S probably benign Het
Thegl T C 5: 77,054,536 I268T possibly damaging Het
Tpcn1 T C 5: 120,542,518 K549R probably damaging Het
Upf3a C A 8: 13,796,573 P318T probably benign Het
Zbtb40 A T 4: 136,998,694 M518K probably damaging Het
Zcchc14 G A 8: 121,651,941 probably benign Het
Zfp687 G A 3: 95,009,128 P861L probably damaging Het
Other mutations in Pik3ap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01412:Pik3ap1 APN 19 41375890 missense possibly damaging 0.95
IGL01697:Pik3ap1 APN 19 41324579 missense probably damaging 1.00
IGL01743:Pik3ap1 APN 19 41292828 splice site probably benign
IGL02006:Pik3ap1 APN 19 41302593 missense probably benign
IGL02507:Pik3ap1 APN 19 41282012 splice site probably benign
IGL02601:Pik3ap1 APN 19 41302442 missense probably benign 0.08
Pintail UTSW 19 41376146 missense probably benign 0.00
sooni UTSW 19 41327909 missense probably damaging 1.00
sothe UTSW 19 41356683 intron probably benign
FR4449:Pik3ap1 UTSW 19 41281946 small insertion probably benign
FR4548:Pik3ap1 UTSW 19 41281945 small insertion probably benign
FR4976:Pik3ap1 UTSW 19 41281945 small insertion probably benign
R0504:Pik3ap1 UTSW 19 41287490 missense probably damaging 1.00
R0505:Pik3ap1 UTSW 19 41324564 missense probably damaging 1.00
R0736:Pik3ap1 UTSW 19 41332319 missense possibly damaging 0.56
R0926:Pik3ap1 UTSW 19 41302525 missense probably benign 0.00
R1521:Pik3ap1 UTSW 19 41321558 missense probably damaging 1.00
R1681:Pik3ap1 UTSW 19 41308529 missense probably damaging 1.00
R1779:Pik3ap1 UTSW 19 41332234 missense probably damaging 1.00
R1924:Pik3ap1 UTSW 19 41302614 missense possibly damaging 0.79
R1945:Pik3ap1 UTSW 19 41274337 missense probably benign
R2327:Pik3ap1 UTSW 19 41296389 missense probably damaging 0.99
R2891:Pik3ap1 UTSW 19 41376061 missense probably benign 0.00
R2892:Pik3ap1 UTSW 19 41376061 missense probably benign 0.00
R2893:Pik3ap1 UTSW 19 41376061 missense probably benign 0.00
R2894:Pik3ap1 UTSW 19 41376061 missense probably benign 0.00
R2918:Pik3ap1 UTSW 19 41302531 missense probably benign 0.00
R4654:Pik3ap1 UTSW 19 41327909 missense probably damaging 1.00
R4811:Pik3ap1 UTSW 19 41302497 missense possibly damaging 0.67
R4855:Pik3ap1 UTSW 19 41327845 missense probably benign 0.13
R4885:Pik3ap1 UTSW 19 41375926 missense probably benign 0.28
R5119:Pik3ap1 UTSW 19 41281976 missense probably benign 0.18
R5261:Pik3ap1 UTSW 19 41376106 missense probably damaging 1.00
R5274:Pik3ap1 UTSW 19 41281952 missense possibly damaging 0.67
R5655:Pik3ap1 UTSW 19 41298241 missense possibly damaging 0.65
R5862:Pik3ap1 UTSW 19 41332345 missense probably damaging 1.00
R5924:Pik3ap1 UTSW 19 41296456 missense probably damaging 1.00
R6015:Pik3ap1 UTSW 19 41328201 missense probably benign 0.22
R6018:Pik3ap1 UTSW 19 41385016 start gained probably benign
R6515:Pik3ap1 UTSW 19 41376146 missense probably benign 0.00
R6792:Pik3ap1 UTSW 19 41321626 missense probably benign 0.14
R7135:Pik3ap1 UTSW 19 41332321 missense probably damaging 1.00
R7162:Pik3ap1 UTSW 19 41321526 missense probably benign 0.03
R7175:Pik3ap1 UTSW 19 41287490 missense probably damaging 0.98
R7313:Pik3ap1 UTSW 19 41296376 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- TGGACACCAGATCTTTCCAAAG -3'
(R):5'- TTCGTAGCCAGAAGACGCAG -3'

Sequencing Primer
(F):5'- AGAGCTTTCTCAATTTTATAGCACG -3'
(R):5'- AGACGCAGACATACCGGCTG -3'
Posted On2015-07-07