Incidental Mutation 'R4352:Npr2'
ID327326
Institutional Source Beutler Lab
Gene Symbol Npr2
Ensembl Gene ENSMUSG00000028469
Gene Namenatriuretic peptide receptor 2
Synonymspwe, cn, guanylyl cyclase-B
MMRRC Submission 041668-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.797) question?
Stock #R4352 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location43631935-43651244 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 43646592 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 647 (S647P)
Ref Sequence ENSEMBL: ENSMUSP00000030191 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030191] [ENSMUST00000084646] [ENSMUST00000107874]
Predicted Effect probably damaging
Transcript: ENSMUST00000030191
AA Change: S647P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030191
Gene: ENSMUSG00000028469
AA Change: S647P

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ANF_receptor 44 399 1.9e-45 PFAM
Pfam:Pkinase_Tyr 518 786 4.7e-39 PFAM
Pfam:Pkinase 535 785 1.2e-32 PFAM
CYCc 825 1019 3.28e-111 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000084646
SMART Domains Protein: ENSMUSP00000081696
Gene: ENSMUSG00000066196

DomainStartEndE-ValueType
low complexity region 26 48 N/A INTRINSIC
low complexity region 121 145 N/A INTRINSIC
low complexity region 148 175 N/A INTRINSIC
low complexity region 230 254 N/A INTRINSIC
low complexity region 303 316 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107874
AA Change: S647P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000103506
Gene: ENSMUSG00000028469
AA Change: S647P

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ANF_receptor 44 399 5.7e-56 PFAM
Pfam:Pkinase_Tyr 518 786 4.1e-39 PFAM
Pfam:Pkinase 533 785 3.8e-34 PFAM
CYCc 825 989 4.37e-57 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123351
SMART Domains Protein: ENSMUSP00000117761
Gene: ENSMUSG00000028469

DomainStartEndE-ValueType
transmembrane domain 28 50 N/A INTRINSIC
Pfam:Pkinase_Tyr 71 173 1.3e-12 PFAM
Pfam:Pkinase 85 170 1.2e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123883
Predicted Effect unknown
Transcript: ENSMUST00000128549
AA Change: S212P
SMART Domains Protein: ENSMUSP00000114385
Gene: ENSMUSG00000028469
AA Change: S212P

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:Pkinase_Tyr 84 352 1e-39 PFAM
Pfam:Pkinase 101 351 2.6e-33 PFAM
CYCc 391 585 3.28e-111 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130093
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143160
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144418
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145817
Predicted Effect probably benign
Transcript: ENSMUST00000149575
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151603
Meta Mutation Damage Score 0.164 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 96% (79/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes natriuretic peptide receptor B, one of two integral membrane receptors for natriuretic peptides. Both NPR1 and NPR2 contain five functional domains: an extracellular ligand-binding domain, a single membrane-spanning region, and intracellularly a protein kinase homology domain, a helical hinge region involved in oligomerization, and a carboxyl-terminal guanylyl cyclase catalytic domain. The protein is the primary receptor for C-type natriuretic peptide (CNP), which upon ligand binding exhibits greatly increased guanylyl cyclase activity. Mutations in this gene are the cause of acromesomelic dysplasia Maroteaux type. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations in this gene result in skeletal abnormalities, malocclusion, and reduced viability. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 C T 6: 128,580,386 A115T probably benign Het
Abtb2 T A 2: 103,683,393 D382E possibly damaging Het
Adamts1 T A 16: 85,802,346 D122V probably benign Het
Ankrd54 A T 15: 79,055,462 F176I probably benign Het
Ano3 T A 2: 110,745,894 E94V possibly damaging Het
Arid1b A T 17: 5,097,584 Q587L possibly damaging Het
Atg2a G A 19: 6,257,457 V1474M probably benign Het
Bcl2a1d A G 9: 88,731,499 V74A probably damaging Het
Bmper A G 9: 23,483,952 I660V probably benign Het
Cdh20 A G 1: 104,979,089 D547G probably damaging Het
Cds2 T A 2: 132,263,445 M1K probably null Het
Ctr9 T A 7: 111,049,318 Y722N probably damaging Het
Ddx47 C T 6: 135,018,055 T161I probably benign Het
Dvl3 T C 16: 20,525,644 Y257H possibly damaging Het
Dzip1 T C 14: 118,883,526 D673G probably benign Het
Emilin2 T C 17: 71,280,731 M129V probably benign Het
Eml1 A T 12: 108,534,837 probably benign Het
Espnl A T 1: 91,334,721 D296V probably damaging Het
Fam161a T G 11: 23,020,798 S109R possibly damaging Het
Fat3 T G 9: 16,246,778 T1179P possibly damaging Het
Gfra1 A T 19: 58,267,024 N330K probably benign Het
Gfy T C 7: 45,177,616 E352G probably benign Het
Gm11639 T A 11: 104,739,314 L957Q probably null Het
Gm12569 A G 11: 51,234,819 N190D possibly damaging Het
Gm20775 A T Y: 10,641,648 noncoding transcript Het
Gm5885 T A 6: 133,531,189 noncoding transcript Het
Gpatch11 T C 17: 78,841,017 L128P probably damaging Het
H2-Q1 A G 17: 35,320,943 N63D possibly damaging Het
Itgb2 A T 10: 77,556,167 N358I probably benign Het
Jmjd1c A G 10: 67,244,809 T2247A probably damaging Het
Kcnma1 T A 14: 23,311,652 K1036I probably damaging Het
Llgl1 C T 11: 60,709,568 P581L probably benign Het
Lrch1 G T 14: 74,818,578 S278R probably damaging Het
Lrp2 C A 2: 69,432,182 probably null Het
Lyn G A 4: 3,789,796 R443H probably damaging Het
Mecom C A 3: 29,966,738 V452L possibly damaging Het
Mpzl1 G A 1: 165,605,807 Q36* probably null Het
Nrp2 A G 1: 62,738,417 D127G probably damaging Het
Otogl A T 10: 107,869,535 C644S probably damaging Het
Pabpc4 C T 4: 123,290,267 T191I probably damaging Het
Paqr3 T C 5: 97,099,596 T218A probably benign Het
Pcdh7 C T 5: 57,722,019 S972L possibly damaging Het
Pcnx2 T C 8: 125,762,851 H1668R probably damaging Het
Prpmp5 T G 6: 132,313,661 Y25S unknown Het
Ralb A G 1: 119,483,552 M19T probably benign Het
Rcan1 A G 16: 92,393,496 I185T probably benign Het
Rnf38 A T 4: 44,149,100 N82K possibly damaging Het
Rock1 T A 18: 10,079,237 Q1077L probably damaging Het
Sesn3 C T 9: 14,320,373 A200V probably damaging Het
Shh T C 5: 28,458,189 E327G probably benign Het
Shmt2 G A 10: 127,518,817 A333V probably damaging Het
Slc15a2 T A 16: 36,772,028 I256F probably benign Het
Sptbn5 T C 2: 120,083,199 noncoding transcript Het
Sst A G 16: 23,889,815 S89P probably damaging Het
Taf10 A G 7: 105,743,407 probably benign Het
Tas2r139 T A 6: 42,141,755 W274R probably damaging Het
Tbc1d20 T A 2: 152,308,194 probably benign Het
Tbc1d5 A G 17: 50,782,401 S584P probably damaging Het
Tcstv1 T C 13: 119,893,871 D75G probably damaging Het
Tex10 T G 4: 48,452,039 T696P possibly damaging Het
Tgfbr1 T C 4: 47,402,863 F206S probably damaging Het
Tmem241 A T 18: 12,113,439 H51Q probably benign Het
Trim5 A T 7: 104,276,808 V182D probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Txnl1 A G 18: 63,671,679 V248A possibly damaging Het
Ubr5 A G 15: 38,041,573 V204A probably benign Het
Ugp2 C T 11: 21,329,026 V387I probably damaging Het
Unc45b G A 11: 82,913,209 D71N probably damaging Het
Usp34 A T 11: 23,320,727 Y37F possibly damaging Het
Zfp943 A T 17: 21,993,123 I397F probably damaging Het
Other mutations in Npr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00790:Npr2 APN 4 43641612 missense possibly damaging 0.51
IGL01116:Npr2 APN 4 43640248 missense probably damaging 0.99
IGL01447:Npr2 APN 4 43640554 missense possibly damaging 0.93
IGL02412:Npr2 APN 4 43647005 missense probably damaging 0.97
IGL02449:Npr2 APN 4 43646641 missense probably damaging 1.00
IGL03120:Npr2 APN 4 43643133 missense probably damaging 0.99
IGL03351:Npr2 APN 4 43640652 missense probably benign 0.36
R0066:Npr2 UTSW 4 43632329 missense probably benign 0.00
R0201:Npr2 UTSW 4 43641617 missense probably damaging 0.98
R0309:Npr2 UTSW 4 43640904 unclassified probably benign
R0437:Npr2 UTSW 4 43648082 missense probably damaging 1.00
R0440:Npr2 UTSW 4 43650315 missense probably damaging 0.99
R0464:Npr2 UTSW 4 43640597 unclassified probably null
R0511:Npr2 UTSW 4 43632801 missense probably benign 0.00
R0576:Npr2 UTSW 4 43640947 missense probably benign 0.01
R0630:Npr2 UTSW 4 43641219 missense probably benign 0.18
R0690:Npr2 UTSW 4 43646991 missense probably damaging 0.98
R1079:Npr2 UTSW 4 43643654 missense probably damaging 1.00
R1140:Npr2 UTSW 4 43648353 missense possibly damaging 0.87
R1171:Npr2 UTSW 4 43647260 missense possibly damaging 0.52
R1741:Npr2 UTSW 4 43643350 missense probably damaging 1.00
R1848:Npr2 UTSW 4 43632384 missense probably benign
R1864:Npr2 UTSW 4 43641258 missense probably benign 0.30
R1919:Npr2 UTSW 4 43640578 missense probably damaging 1.00
R2054:Npr2 UTSW 4 43646560 missense probably damaging 0.99
R2106:Npr2 UTSW 4 43644329 missense probably damaging 1.00
R2143:Npr2 UTSW 4 43648166 missense probably damaging 1.00
R2306:Npr2 UTSW 4 43633609 missense probably damaging 1.00
R2372:Npr2 UTSW 4 43650432 missense probably damaging 1.00
R2889:Npr2 UTSW 4 43641600 missense probably benign 0.26
R3076:Npr2 UTSW 4 43640182 missense probably damaging 1.00
R3078:Npr2 UTSW 4 43640182 missense probably damaging 1.00
R3711:Npr2 UTSW 4 43643378 missense probably benign 0.00
R3730:Npr2 UTSW 4 43640999 missense possibly damaging 0.93
R4301:Npr2 UTSW 4 43641332 critical splice donor site probably null
R4412:Npr2 UTSW 4 43644150 missense probably damaging 0.99
R4583:Npr2 UTSW 4 43633522 splice site probably null
R4593:Npr2 UTSW 4 43647323 unclassified probably benign
R5042:Npr2 UTSW 4 43647002 missense probably damaging 1.00
R5213:Npr2 UTSW 4 43640673 critical splice donor site probably null
R5546:Npr2 UTSW 4 43650150 missense probably damaging 1.00
R5784:Npr2 UTSW 4 43632801 missense probably benign 0.00
R5787:Npr2 UTSW 4 43633593 missense possibly damaging 0.69
R6364:Npr2 UTSW 4 43643622 missense probably damaging 1.00
R6925:Npr2 UTSW 4 43647553 missense probably damaging 1.00
R6949:Npr2 UTSW 4 43640597 missense probably damaging 1.00
R7380:Npr2 UTSW 4 43641254 missense probably damaging 1.00
R7432:Npr2 UTSW 4 43647155 missense probably damaging 0.96
R7500:Npr2 UTSW 4 43650415 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGATGCTGTTTACATGGGAAG -3'
(R):5'- ACCAAGGCTTGAAGGGTGAC -3'

Sequencing Primer
(F):5'- TCCAGTCGAGGCTCTACAG -3'
(R):5'- CTTGAAGGGTGACATAAAAGGTAGGC -3'
Posted On2015-07-07