Incidental Mutation 'R4352:Jmjd1c'
ID327348
Institutional Source Beutler Lab
Gene Symbol Jmjd1c
Ensembl Gene ENSMUSG00000037876
Gene Namejumonji domain containing 1C
SynonymsTRIP8, D630035I23Rik, 5430433L24Rik
MMRRC Submission 041668-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.628) question?
Stock #R4352 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location67096125-67256326 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 67244809 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 2247 (T2247A)
Ref Sequence ENSEMBL: ENSMUSP00000134551 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051446] [ENSMUST00000173689] [ENSMUST00000174408]
Predicted Effect probably damaging
Transcript: ENSMUST00000051446
AA Change: T2246A

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000056227
Gene: ENSMUSG00000037876
AA Change: T2246A

DomainStartEndE-ValueType
Blast:JmjC 143 2236 N/A BLAST
JmjC 2264 2488 3.29e-53 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173236
Predicted Effect probably damaging
Transcript: ENSMUST00000173689
AA Change: T2066A

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000133700
Gene: ENSMUSG00000037876
AA Change: T2066A

DomainStartEndE-ValueType
Blast:JmjC 1 2056 N/A BLAST
JmjC 2084 2308 3.29e-53 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173762
Predicted Effect probably damaging
Transcript: ENSMUST00000174408
AA Change: T2247A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000134551
Gene: ENSMUSG00000037876
AA Change: T2247A

DomainStartEndE-ValueType
Blast:JmjC 143 2237 N/A BLAST
JmjC 2265 2489 3.29e-53 SMART
Meta Mutation Damage Score 0.1394 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 96% (79/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene interacts with thyroid hormone receptors and contains a jumonji domain. It is a candidate histone demethylase and is thought to be a coactivator for key transcription factors. It plays a role in the DNA-damage response pathway by demethylating the mediator of DNA damage checkpoint 1 (MDC1) protein, and is required for the survival of acute myeloid leukemia. Mutations in this gene are associated with Rett syndrome and intellectual disability. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a null allele exhibit an age-dependent male infertility phenotype, characterized by early loss of undifferentiated spermatogonia, and a progressive reduction in testis size/weight and male germ cells, partly due to increased male germ cell apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 C T 6: 128,580,386 A115T probably benign Het
Abtb2 T A 2: 103,683,393 D382E possibly damaging Het
Adamts1 T A 16: 85,802,346 D122V probably benign Het
Ankrd54 A T 15: 79,055,462 F176I probably benign Het
Ano3 T A 2: 110,745,894 E94V possibly damaging Het
Arid1b A T 17: 5,097,584 Q587L possibly damaging Het
Atg2a G A 19: 6,257,457 V1474M probably benign Het
Bcl2a1d A G 9: 88,731,499 V74A probably damaging Het
Bmper A G 9: 23,483,952 I660V probably benign Het
Cdh20 A G 1: 104,979,089 D547G probably damaging Het
Cds2 T A 2: 132,263,445 M1K probably null Het
Ctr9 T A 7: 111,049,318 Y722N probably damaging Het
Ddx47 C T 6: 135,018,055 T161I probably benign Het
Dvl3 T C 16: 20,525,644 Y257H possibly damaging Het
Dzip1 T C 14: 118,883,526 D673G probably benign Het
Emilin2 T C 17: 71,280,731 M129V probably benign Het
Eml1 A T 12: 108,534,837 probably benign Het
Espnl A T 1: 91,334,721 D296V probably damaging Het
Fam161a T G 11: 23,020,798 S109R possibly damaging Het
Fat3 T G 9: 16,246,778 T1179P possibly damaging Het
Gfra1 A T 19: 58,267,024 N330K probably benign Het
Gfy T C 7: 45,177,616 E352G probably benign Het
Gm11639 T A 11: 104,739,314 L957Q probably null Het
Gm12569 A G 11: 51,234,819 N190D possibly damaging Het
Gm20775 A T Y: 10,641,648 noncoding transcript Het
Gm5885 T A 6: 133,531,189 noncoding transcript Het
Gpatch11 T C 17: 78,841,017 L128P probably damaging Het
H2-Q1 A G 17: 35,320,943 N63D possibly damaging Het
Itgb2 A T 10: 77,556,167 N358I probably benign Het
Kcnma1 T A 14: 23,311,652 K1036I probably damaging Het
Llgl1 C T 11: 60,709,568 P581L probably benign Het
Lrch1 G T 14: 74,818,578 S278R probably damaging Het
Lrp2 C A 2: 69,432,182 probably null Het
Lyn G A 4: 3,789,796 R443H probably damaging Het
Mecom C A 3: 29,966,738 V452L possibly damaging Het
Mpzl1 G A 1: 165,605,807 Q36* probably null Het
Npr2 T C 4: 43,646,592 S647P probably damaging Het
Nrp2 A G 1: 62,738,417 D127G probably damaging Het
Otogl A T 10: 107,869,535 C644S probably damaging Het
Pabpc4 C T 4: 123,290,267 T191I probably damaging Het
Paqr3 T C 5: 97,099,596 T218A probably benign Het
Pcdh7 C T 5: 57,722,019 S972L possibly damaging Het
Pcnx2 T C 8: 125,762,851 H1668R probably damaging Het
Prpmp5 T G 6: 132,313,661 Y25S unknown Het
Ralb A G 1: 119,483,552 M19T probably benign Het
Rcan1 A G 16: 92,393,496 I185T probably benign Het
Rnf38 A T 4: 44,149,100 N82K possibly damaging Het
Rock1 T A 18: 10,079,237 Q1077L probably damaging Het
Sesn3 C T 9: 14,320,373 A200V probably damaging Het
Shh T C 5: 28,458,189 E327G probably benign Het
Shmt2 G A 10: 127,518,817 A333V probably damaging Het
Slc15a2 T A 16: 36,772,028 I256F probably benign Het
Sptbn5 T C 2: 120,083,199 noncoding transcript Het
Sst A G 16: 23,889,815 S89P probably damaging Het
Taf10 A G 7: 105,743,407 probably benign Het
Tas2r139 T A 6: 42,141,755 W274R probably damaging Het
Tbc1d20 T A 2: 152,308,194 probably benign Het
Tbc1d5 A G 17: 50,782,401 S584P probably damaging Het
Tcstv1 T C 13: 119,893,871 D75G probably damaging Het
Tex10 T G 4: 48,452,039 T696P possibly damaging Het
Tgfbr1 T C 4: 47,402,863 F206S probably damaging Het
Tmem241 A T 18: 12,113,439 H51Q probably benign Het
Trim5 A T 7: 104,276,808 V182D probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Txnl1 A G 18: 63,671,679 V248A possibly damaging Het
Ubr5 A G 15: 38,041,573 V204A probably benign Het
Ugp2 C T 11: 21,329,026 V387I probably damaging Het
Unc45b G A 11: 82,913,209 D71N probably damaging Het
Usp34 A T 11: 23,320,727 Y37F possibly damaging Het
Zfp943 A T 17: 21,993,123 I397F probably damaging Het
Other mutations in Jmjd1c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01062:Jmjd1c APN 10 67226715 missense probably damaging 1.00
IGL01604:Jmjd1c APN 10 67249762 missense probably damaging 1.00
IGL01753:Jmjd1c APN 10 67232015 missense probably damaging 1.00
IGL02081:Jmjd1c APN 10 67219526 missense probably benign 0.02
IGL02128:Jmjd1c APN 10 67243869 missense probably damaging 1.00
IGL02134:Jmjd1c APN 10 67220392 missense possibly damaging 0.87
IGL02215:Jmjd1c APN 10 67220322 missense probably damaging 1.00
IGL02408:Jmjd1c APN 10 67226382 missense probably benign 0.00
IGL02502:Jmjd1c APN 10 67225861 missense probably benign 0.13
IGL02546:Jmjd1c APN 10 67225336 missense possibly damaging 0.94
IGL02943:Jmjd1c APN 10 67219654 missense probably damaging 0.99
IGL03171:Jmjd1c APN 10 67225498 missense possibly damaging 0.89
IGL03261:Jmjd1c APN 10 67232070 missense probably damaging 0.99
accordion UTSW 10 67233414 missense probably damaging 0.99
PIT4378001:Jmjd1c UTSW 10 67229913 missense probably damaging 1.00
R0126:Jmjd1c UTSW 10 67219326 missense probably damaging 0.98
R0133:Jmjd1c UTSW 10 67240808 missense probably benign 0.22
R0201:Jmjd1c UTSW 10 67219109 missense unknown
R0396:Jmjd1c UTSW 10 67219523 missense possibly damaging 0.82
R0401:Jmjd1c UTSW 10 67220382 missense probably damaging 1.00
R0452:Jmjd1c UTSW 10 67255482 missense probably benign 0.28
R0488:Jmjd1c UTSW 10 67240727 missense probably damaging 0.99
R0504:Jmjd1c UTSW 10 67225755 missense probably damaging 1.00
R0555:Jmjd1c UTSW 10 67225789 missense probably benign 0.01
R0673:Jmjd1c UTSW 10 67226809 missense probably damaging 1.00
R0718:Jmjd1c UTSW 10 67218946 splice site probably null
R0755:Jmjd1c UTSW 10 67096599 intron probably benign
R1142:Jmjd1c UTSW 10 67225345 missense probably damaging 1.00
R1196:Jmjd1c UTSW 10 67239236 splice site probably benign
R1413:Jmjd1c UTSW 10 67249750 missense probably damaging 1.00
R1619:Jmjd1c UTSW 10 67219875 missense probably benign 0.25
R1676:Jmjd1c UTSW 10 67224809 missense probably benign 0.02
R1751:Jmjd1c UTSW 10 67225690 missense probably benign
R1950:Jmjd1c UTSW 10 67239922 missense possibly damaging 0.71
R1968:Jmjd1c UTSW 10 67225440 missense probably damaging 1.00
R2049:Jmjd1c UTSW 10 67157998 nonsense probably null
R2061:Jmjd1c UTSW 10 67218426 missense probably damaging 1.00
R2202:Jmjd1c UTSW 10 67239463 splice site probably null
R2203:Jmjd1c UTSW 10 67239463 splice site probably null
R2256:Jmjd1c UTSW 10 67225294 missense probably damaging 1.00
R2312:Jmjd1c UTSW 10 67238850 missense probably damaging 0.98
R2349:Jmjd1c UTSW 10 67255500 missense probably benign
R2392:Jmjd1c UTSW 10 67229904 missense probably damaging 1.00
R3015:Jmjd1c UTSW 10 67157932 missense probably damaging 1.00
R3110:Jmjd1c UTSW 10 67240084 splice site probably benign
R4043:Jmjd1c UTSW 10 67219466 missense possibly damaging 0.55
R4097:Jmjd1c UTSW 10 67219008 missense probably benign 0.09
R4118:Jmjd1c UTSW 10 67219753 missense probably damaging 0.96
R4193:Jmjd1c UTSW 10 67096681 intron probably benign
R4577:Jmjd1c UTSW 10 67249750 missense probably damaging 1.00
R4630:Jmjd1c UTSW 10 67157974 nonsense probably null
R4717:Jmjd1c UTSW 10 67158051 nonsense probably null
R4741:Jmjd1c UTSW 10 67224939 missense possibly damaging 0.56
R4774:Jmjd1c UTSW 10 67224792 missense possibly damaging 0.45
R4836:Jmjd1c UTSW 10 67233446 missense probably benign 0.21
R4914:Jmjd1c UTSW 10 67218971 missense probably damaging 1.00
R4939:Jmjd1c UTSW 10 67246137 missense possibly damaging 0.93
R5211:Jmjd1c UTSW 10 67232016 missense probably damaging 1.00
R5215:Jmjd1c UTSW 10 67240701 missense possibly damaging 0.93
R5514:Jmjd1c UTSW 10 67218149 missense probably damaging 1.00
R5530:Jmjd1c UTSW 10 67249762 missense probably damaging 1.00
R5624:Jmjd1c UTSW 10 67233414 missense probably damaging 0.99
R5640:Jmjd1c UTSW 10 67226078 missense probably benign 0.10
R5654:Jmjd1c UTSW 10 67230006 missense probably benign 0.10
R5742:Jmjd1c UTSW 10 67220333 missense probably benign 0.02
R5764:Jmjd1c UTSW 10 67226512 missense probably damaging 1.00
R6118:Jmjd1c UTSW 10 67240012 missense probably damaging 1.00
R6163:Jmjd1c UTSW 10 67248048 missense possibly damaging 0.46
R6256:Jmjd1c UTSW 10 67220408 missense probably damaging 1.00
R6266:Jmjd1c UTSW 10 67249660 missense probably damaging 0.96
R6358:Jmjd1c UTSW 10 67225939 missense probably benign
R6430:Jmjd1c UTSW 10 67224160 missense possibly damaging 0.87
R6455:Jmjd1c UTSW 10 67226016 missense probably benign 0.10
R6887:Jmjd1c UTSW 10 67189820 missense possibly damaging 0.74
R6895:Jmjd1c UTSW 10 67217090 missense probably benign 0.00
R7041:Jmjd1c UTSW 10 67220609 missense possibly damaging 0.90
R7095:Jmjd1c UTSW 10 67219632 missense probably benign 0.39
R7113:Jmjd1c UTSW 10 67158001 missense probably damaging 0.98
R7225:Jmjd1c UTSW 10 67226065 missense probably benign 0.00
R7249:Jmjd1c UTSW 10 67189817 missense probably benign 0.01
R7361:Jmjd1c UTSW 10 67218364 missense probably benign 0.10
R7383:Jmjd1c UTSW 10 67189758 missense probably benign 0.14
R7460:Jmjd1c UTSW 10 67217036 missense probably benign 0.24
R7475:Jmjd1c UTSW 10 67225313 missense probably benign 0.22
R7502:Jmjd1c UTSW 10 67232015 missense probably damaging 0.99
Z1088:Jmjd1c UTSW 10 67238174 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCATGTATCCCATAGTAAACTCTTC -3'
(R):5'- ACAAGTCTCCACCTTGATGAG -3'

Sequencing Primer
(F):5'- AGGTCCAGGAGATCCAATGTTCTC -3'
(R):5'- GGTTCAGCAGTAGTTAGC -3'
Posted On2015-07-07